Incidental Mutation 'R5378:Arfgef2'
ID425675
Institutional Source Beutler Lab
Gene Symbol Arfgef2
Ensembl Gene ENSMUSG00000074582
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
SynonymsE230011G24Rik, BIG2
MMRRC Submission 042953-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R5378 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location166805588-166898052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 166873628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1331 (V1331D)
Ref Sequence ENSEMBL: ENSMUSP00000096677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099078]
Predicted Effect probably damaging
Transcript: ENSMUST00000099078
AA Change: V1331D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: V1331D

DomainStartEndE-ValueType
Pfam:DCB 7 200 1.6e-40 PFAM
Pfam:Sec7_N 377 536 3.7e-53 PFAM
Blast:Sec7 549 598 8e-18 BLAST
low complexity region 621 633 N/A INTRINSIC
Sec7 647 834 1.55e-97 SMART
Blast:Sec7 853 888 2e-11 BLAST
Blast:Sec7 902 941 4e-15 BLAST
low complexity region 1044 1055 N/A INTRINSIC
Pfam:DUF1981 1174 1257 6e-38 PFAM
low complexity region 1719 1729 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,578,277 F39L probably benign Het
Abca2 T G 2: 25,446,068 L2150R probably damaging Het
Apob T A 12: 8,011,865 V3449D probably damaging Het
Bora A G 14: 99,068,493 N433D probably damaging Het
Cand2 G A 6: 115,801,951 A1159T probably benign Het
Ccser1 C T 6: 61,311,666 A271V probably benign Het
Ccser2 G A 14: 36,879,434 T331I possibly damaging Het
Cemip A G 7: 83,958,525 S758P probably damaging Het
Cenpf C T 1: 189,653,466 V2206I possibly damaging Het
Chrnb1 A T 11: 69,785,181 S412T probably benign Het
Cks1b A C 3: 89,416,301 W54G probably damaging Het
Col5a3 C T 9: 20,797,576 V630M unknown Het
Dnajb14 A G 3: 137,885,378 D30G probably benign Het
Dpp8 T C 9: 65,078,014 Y785H probably damaging Het
Dsel T A 1: 111,862,821 probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Esp8 G A 17: 40,530,142 C98Y unknown Het
F11 C A 8: 45,252,143 M120I probably benign Het
Fsip2 T C 2: 82,989,841 F5306S possibly damaging Het
Gm4841 T C 18: 60,271,041 probably null Het
Gpr180 T A 14: 118,139,839 L84Q probably benign Het
Grwd1 A T 7: 45,830,081 D123E probably benign Het
Hsfy2 T C 1: 56,636,668 R237G probably benign Het
Htr5a A G 5: 27,850,995 Y328C probably damaging Het
Klrb1f G A 6: 129,053,831 A127T probably damaging Het
Mcpt4 A T 14: 56,062,293 probably null Het
Muc5b T C 7: 141,862,203 V2962A unknown Het
Olfr1095 A T 2: 86,851,463 N78K probably benign Het
Olfr601 T A 7: 103,358,445 I250F probably damaging Het
Otog A T 7: 46,255,004 T518S probably damaging Het
Phgdh A T 3: 98,321,323 probably null Het
Pip5kl1 A T 2: 32,579,094 T213S probably benign Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Prg4 T A 1: 150,455,226 probably benign Het
Prpf40a T A 2: 53,145,876 D621V probably damaging Het
Ptprz1 A T 6: 23,007,402 I1655F probably damaging Het
Rbm28 T C 6: 29,128,559 K55E probably damaging Het
Rbm43 A T 2: 51,925,621 V196E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc4 T A 2: 121,452,380 M434L possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35f1 A T 10: 52,691,061 H22L possibly damaging Het
Smg6 A G 11: 75,041,994 D98G possibly damaging Het
Strbp A G 2: 37,599,174 Y527H probably damaging Het
Strbp A G 2: 37,600,806 V479A probably benign Het
Tcrg-C2 T C 13: 19,305,127 Y145C unknown Het
Tdg G T 10: 82,641,471 V119L probably benign Het
Trav10d G A 14: 52,811,368 R72H probably benign Het
Trim25 T C 11: 89,009,267 L280P probably damaging Het
Tsc22d4 A G 5: 137,762,464 D49G probably damaging Het
Ttn T C 2: 76,890,190 probably benign Het
Tyr T A 7: 87,472,495 H363L probably damaging Het
Ubr5 A G 15: 37,989,578 S2020P probably damaging Het
Usp9y T C Y: 1,315,928 D2069G probably damaging Het
Vmn1r170 T C 7: 23,606,538 W122R probably benign Het
Wdr7 G A 18: 63,825,239 probably null Het
Ylpm1 T A 12: 85,030,255 H793Q probably damaging Het
Zadh2 G A 18: 84,094,678 A160T probably damaging Het
Zfp266 G A 9: 20,499,363 T506I probably damaging Het
Zfp518a T C 19: 40,915,856 S1410P probably damaging Het
Other mutations in Arfgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Arfgef2 APN 2 166885853 missense probably damaging 1.00
IGL01323:Arfgef2 APN 2 166871495 missense probably damaging 1.00
IGL01415:Arfgef2 APN 2 166867355 missense probably damaging 0.98
IGL01638:Arfgef2 APN 2 166873945 missense probably damaging 0.97
IGL02618:Arfgef2 APN 2 166853313 missense probably damaging 1.00
IGL02899:Arfgef2 APN 2 166869051 splice site probably benign
IGL03012:Arfgef2 APN 2 166868888 splice site probably benign
IGL03063:Arfgef2 APN 2 166859782 splice site probably benign
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0116:Arfgef2 UTSW 2 166873683 missense probably damaging 1.00
R0128:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0130:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0208:Arfgef2 UTSW 2 166867422 missense probably damaging 1.00
R0379:Arfgef2 UTSW 2 166860400 critical splice donor site probably null
R0945:Arfgef2 UTSW 2 166826969 unclassified probably benign
R1226:Arfgef2 UTSW 2 166827640 missense probably damaging 1.00
R1252:Arfgef2 UTSW 2 166859957 missense probably damaging 1.00
R1695:Arfgef2 UTSW 2 166864712 missense probably damaging 0.98
R1696:Arfgef2 UTSW 2 166861638 missense probably damaging 1.00
R1742:Arfgef2 UTSW 2 166866980 missense probably damaging 1.00
R1935:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1936:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1939:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R2276:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2279:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2349:Arfgef2 UTSW 2 166852028 missense probably damaging 1.00
R2359:Arfgef2 UTSW 2 166860619 missense probably damaging 1.00
R2414:Arfgef2 UTSW 2 166845504 missense probably benign 0.00
R2519:Arfgef2 UTSW 2 166881244 missense probably benign 0.03
R2938:Arfgef2 UTSW 2 166894733 missense probably damaging 1.00
R3696:Arfgef2 UTSW 2 166853300 nonsense probably null
R4022:Arfgef2 UTSW 2 166873945 missense probably benign 0.01
R4227:Arfgef2 UTSW 2 166867324 missense probably damaging 1.00
R4293:Arfgef2 UTSW 2 166890291 missense probably benign
R4455:Arfgef2 UTSW 2 166894715 missense probably benign 0.43
R4499:Arfgef2 UTSW 2 166885814 missense probably damaging 0.99
R4570:Arfgef2 UTSW 2 166856538 missense probably damaging 0.99
R4888:Arfgef2 UTSW 2 166835613 missense probably damaging 1.00
R4893:Arfgef2 UTSW 2 166866956 missense probably benign
R5032:Arfgef2 UTSW 2 166878544 missense probably benign
R5191:Arfgef2 UTSW 2 166876511 missense probably damaging 1.00
R5200:Arfgef2 UTSW 2 166860684 missense probably benign 0.00
R5318:Arfgef2 UTSW 2 166873971 missense probably damaging 1.00
R5537:Arfgef2 UTSW 2 166856593 splice site probably null
R5866:Arfgef2 UTSW 2 166836257 missense possibly damaging 0.88
R5878:Arfgef2 UTSW 2 166870217 missense probably benign 0.41
R5972:Arfgef2 UTSW 2 166891836 missense probably damaging 1.00
R6147:Arfgef2 UTSW 2 166871495 missense probably damaging 1.00
R6293:Arfgef2 UTSW 2 166873588 missense possibly damaging 0.92
R6323:Arfgef2 UTSW 2 166834484 missense probably damaging 1.00
R6338:Arfgef2 UTSW 2 166845570 missense probably damaging 1.00
R6538:Arfgef2 UTSW 2 166893621 splice site probably null
R6726:Arfgef2 UTSW 2 166893620 critical splice donor site probably null
R7047:Arfgef2 UTSW 2 166851945 splice site probably null
R7086:Arfgef2 UTSW 2 166876616 missense probably damaging 1.00
R7108:Arfgef2 UTSW 2 166873608 missense possibly damaging 0.80
R7155:Arfgef2 UTSW 2 166865813 missense probably benign 0.19
R7159:Arfgef2 UTSW 2 166826928 missense probably benign
X0040:Arfgef2 UTSW 2 166859883 missense probably damaging 1.00
X0063:Arfgef2 UTSW 2 166891841 missense probably benign 0.32
Z1088:Arfgef2 UTSW 2 166893595 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCTAGACTTCGGAAGAGAGTTTGG -3'
(R):5'- CAAACATGACCGTGAGTCCC -3'

Sequencing Primer
(F):5'- TTGGGAAAAGATTGTCTAGAGCCTC -3'
(R):5'- TGGCCAAACTGAGATGGAGGC -3'
Posted On2016-08-04