Incidental Mutation 'R5379:Farp1'
ID425776
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission 042954-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R5379 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121256757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 550 (V550A)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026635
AA Change: V550A

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: V550A

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137971
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,146,532 L640Q probably damaging Het
Afap1l1 T C 18: 61,758,650 E32G probably damaging Het
Atp1a1 T A 3: 101,582,095 M734L probably benign Het
B4galt6 T C 18: 20,689,239 D294G probably damaging Het
Baz1a T G 12: 54,894,348 D1539A probably damaging Het
Bmper T A 9: 23,297,224 S141T probably benign Het
Camkv T C 9: 107,945,346 V20A probably damaging Het
Chst8 A G 7: 34,675,854 Y187H probably damaging Het
Coro1c A G 5: 113,845,382 Y362H probably damaging Het
Csmd3 C A 15: 47,636,450 G3008* probably null Het
Dnah17 T C 11: 118,117,203 probably benign Het
Dnajb1 C T 8: 83,608,506 R59C possibly damaging Het
Dpf1 A G 7: 29,304,108 K10E probably benign Het
Eif5 T C 12: 111,543,555 L311P probably damaging Het
Eqtn A G 4: 94,907,588 F251S probably damaging Het
Fam208b T C 13: 3,588,496 R412G probably benign Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Fat2 T C 11: 55,303,941 T1091A probably damaging Het
Fbxo33 A G 12: 59,219,460 probably benign Het
Fndc5 A T 4: 129,142,094 I175F probably damaging Het
Gm13023 A G 4: 143,794,923 I370V probably benign Het
Gtf2ird2 G C 5: 134,217,468 R856P probably benign Het
Hc A T 2: 34,991,065 F1481I probably damaging Het
Helz2 T A 2: 181,235,069 T1211S probably benign Het
Hmcn2 G A 2: 31,409,011 V2790M probably damaging Het
Ighv1-82 T C 12: 115,952,677 Y71C probably damaging Het
Itgam A G 7: 128,112,388 D725G probably damaging Het
Kif9 T C 9: 110,521,303 V754A probably benign Het
Larp4b C A 13: 9,136,909 T91K probably benign Het
Mki67 T C 7: 135,697,461 E1948G possibly damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrgprb13 A T 7: 48,311,748 noncoding transcript Het
Nlrc4 A T 17: 74,448,083 L46* probably null Het
Olfr157 A G 4: 43,836,010 I160T probably benign Het
Olfr836 A T 9: 19,121,077 T38S probably damaging Het
Olfr933 T C 9: 38,975,855 Y60H possibly damaging Het
Orm1 A G 4: 63,345,993 probably null Het
Parva A T 7: 112,579,720 H311L probably benign Het
Proca1 C A 11: 78,205,266 S154R probably damaging Het
R3hdm2 T C 10: 127,471,902 V344A probably damaging Het
Rabep1 A T 11: 70,908,421 K293N probably damaging Het
Ranbp6 A G 19: 29,811,683 V423A probably damaging Het
Rnf20 T A 4: 49,652,639 Y711N possibly damaging Het
Sf3b1 A T 1: 55,003,150 M498K possibly damaging Het
Sin3a T C 9: 57,110,988 M897T probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srbd1 A C 17: 86,001,536 I738S possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Svep1 A G 4: 58,072,991 V2106A possibly damaging Het
Tex47 G A 5: 7,304,843 R8Q probably null Het
Trpc7 A G 13: 56,804,550 Y548H probably damaging Het
Vmn1r170 A T 7: 23,606,629 H152L possibly damaging Het
Zfp184 A G 13: 21,959,881 I586V probably damaging Het
Zfp454 T C 11: 50,883,802 T15A probably damaging Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGGAAATAGGCTTCTTTAGACTTG -3'
(R):5'- CGTTGACTGCCATAACCCAG -3'

Sequencing Primer
(F):5'- AGGCTTCTTTAGACTTGATAGTAGC -3'
(R):5'- CCATAACCCAGGGTCAGGATG -3'
Posted On2016-08-04