Incidental Mutation 'R5379:Srbd1'
ID425779
Institutional Source Beutler Lab
Gene Symbol Srbd1
Ensembl Gene ENSMUSG00000024135
Gene NameS1 RNA binding domain 1
Synonyms
MMRRC Submission 042954-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5379 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location85984665-86145175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86001536 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 738 (I738S)
Ref Sequence ENSEMBL: ENSMUSP00000092810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095187]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095187
AA Change: I738S

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092810
Gene: ENSMUSG00000024135
AA Change: I738S

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 104 128 N/A INTRINSIC
Pfam:Tex_N 213 403 2.8e-43 PFAM
YqgFc 532 631 4.1e-32 SMART
Pfam:HHH_7 668 764 1.6e-6 PFAM
Pfam:HHH_3 698 762 4.2e-25 PFAM
S1 903 978 7e-15 SMART
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,146,532 L640Q probably damaging Het
Afap1l1 T C 18: 61,758,650 E32G probably damaging Het
Atp1a1 T A 3: 101,582,095 M734L probably benign Het
B4galt6 T C 18: 20,689,239 D294G probably damaging Het
Baz1a T G 12: 54,894,348 D1539A probably damaging Het
Bmper T A 9: 23,297,224 S141T probably benign Het
Camkv T C 9: 107,945,346 V20A probably damaging Het
Chst8 A G 7: 34,675,854 Y187H probably damaging Het
Coro1c A G 5: 113,845,382 Y362H probably damaging Het
Csmd3 C A 15: 47,636,450 G3008* probably null Het
Dnah17 T C 11: 118,117,203 probably benign Het
Dnajb1 C T 8: 83,608,506 R59C possibly damaging Het
Dpf1 A G 7: 29,304,108 K10E probably benign Het
Eif5 T C 12: 111,543,555 L311P probably damaging Het
Eqtn A G 4: 94,907,588 F251S probably damaging Het
Fam208b T C 13: 3,588,496 R412G probably benign Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Farp1 T C 14: 121,256,757 V550A possibly damaging Het
Fat2 T C 11: 55,303,941 T1091A probably damaging Het
Fbxo33 A G 12: 59,219,460 probably benign Het
Fndc5 A T 4: 129,142,094 I175F probably damaging Het
Gm13023 A G 4: 143,794,923 I370V probably benign Het
Gtf2ird2 G C 5: 134,217,468 R856P probably benign Het
Hc A T 2: 34,991,065 F1481I probably damaging Het
Helz2 T A 2: 181,235,069 T1211S probably benign Het
Hmcn2 G A 2: 31,409,011 V2790M probably damaging Het
Ighv1-82 T C 12: 115,952,677 Y71C probably damaging Het
Itgam A G 7: 128,112,388 D725G probably damaging Het
Kif9 T C 9: 110,521,303 V754A probably benign Het
Larp4b C A 13: 9,136,909 T91K probably benign Het
Mki67 T C 7: 135,697,461 E1948G possibly damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrgprb13 A T 7: 48,311,748 noncoding transcript Het
Nlrc4 A T 17: 74,448,083 L46* probably null Het
Olfr157 A G 4: 43,836,010 I160T probably benign Het
Olfr836 A T 9: 19,121,077 T38S probably damaging Het
Olfr933 T C 9: 38,975,855 Y60H possibly damaging Het
Orm1 A G 4: 63,345,993 probably null Het
Parva A T 7: 112,579,720 H311L probably benign Het
Proca1 C A 11: 78,205,266 S154R probably damaging Het
R3hdm2 T C 10: 127,471,902 V344A probably damaging Het
Rabep1 A T 11: 70,908,421 K293N probably damaging Het
Ranbp6 A G 19: 29,811,683 V423A probably damaging Het
Rnf20 T A 4: 49,652,639 Y711N possibly damaging Het
Sf3b1 A T 1: 55,003,150 M498K possibly damaging Het
Sin3a T C 9: 57,110,988 M897T probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Svep1 A G 4: 58,072,991 V2106A possibly damaging Het
Tex47 G A 5: 7,304,843 R8Q probably null Het
Trpc7 A G 13: 56,804,550 Y548H probably damaging Het
Vmn1r170 A T 7: 23,606,629 H152L possibly damaging Het
Zfp184 A G 13: 21,959,881 I586V probably damaging Het
Zfp454 T C 11: 50,883,802 T15A probably damaging Het
Other mutations in Srbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Srbd1 APN 17 86115209 missense probably damaging 1.00
IGL00988:Srbd1 APN 17 86130270 missense probably damaging 0.96
IGL01111:Srbd1 APN 17 86098533 missense probably benign 0.15
IGL02186:Srbd1 APN 17 86109231 missense probably benign
IGL02233:Srbd1 APN 17 86098622 splice site probably null
IGL02307:Srbd1 APN 17 86126188 missense probably damaging 1.00
IGL02392:Srbd1 APN 17 85988373 missense probably benign 0.34
IGL02831:Srbd1 APN 17 86003871 missense probably damaging 1.00
IGL03299:Srbd1 APN 17 86120659 missense possibly damaging 0.95
PIT4494001:Srbd1 UTSW 17 86142359 critical splice donor site probably null
PIT4677001:Srbd1 UTSW 17 86115212 nonsense probably null
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0233:Srbd1 UTSW 17 86057745 missense probably damaging 1.00
R0464:Srbd1 UTSW 17 86120002 missense probably damaging 1.00
R0692:Srbd1 UTSW 17 86136460 missense probably benign 0.25
R0771:Srbd1 UTSW 17 86130254 missense probably benign 0.09
R1074:Srbd1 UTSW 17 86003952 missense probably damaging 1.00
R1173:Srbd1 UTSW 17 86098512 missense probably null 1.00
R1446:Srbd1 UTSW 17 86139152 missense probably benign 0.44
R1587:Srbd1 UTSW 17 85985437 missense probably damaging 1.00
R1780:Srbd1 UTSW 17 86057685 missense probably damaging 1.00
R1865:Srbd1 UTSW 17 86115304 splice site probably benign
R1933:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R1934:Srbd1 UTSW 17 86102893 missense probably damaging 1.00
R2002:Srbd1 UTSW 17 86142400 missense probably benign
R2228:Srbd1 UTSW 17 85985223 missense probably damaging 1.00
R3160:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3162:Srbd1 UTSW 17 86130215 missense probably benign 0.03
R3439:Srbd1 UTSW 17 86057759 missense probably benign 0.01
R3611:Srbd1 UTSW 17 86102927 missense probably benign 0.03
R4255:Srbd1 UTSW 17 86102922 missense possibly damaging 0.80
R4300:Srbd1 UTSW 17 85985204 missense probably damaging 0.98
R4319:Srbd1 UTSW 17 86051150 missense probably damaging 1.00
R4619:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4620:Srbd1 UTSW 17 86109265 missense probably benign 0.30
R4629:Srbd1 UTSW 17 86120672 missense probably damaging 0.99
R5469:Srbd1 UTSW 17 86119942 missense possibly damaging 0.77
R5587:Srbd1 UTSW 17 86127801 missense probably damaging 0.99
R5726:Srbd1 UTSW 17 86120729 missense possibly damaging 0.89
R6166:Srbd1 UTSW 17 86099268 missense probably damaging 1.00
R6237:Srbd1 UTSW 17 85985295 missense probably damaging 0.99
R6696:Srbd1 UTSW 17 86139191 missense possibly damaging 0.46
R6971:Srbd1 UTSW 17 86099290 missense possibly damaging 0.79
R6986:Srbd1 UTSW 17 85985222 missense probably damaging 1.00
R7018:Srbd1 UTSW 17 86136415 missense possibly damaging 0.93
R7082:Srbd1 UTSW 17 86057732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATCTAGAGCTTTCGGC -3'
(R):5'- TCCAGTATCACAAGCAGCAG -3'

Sequencing Primer
(F):5'- CATCTAGAGCTTTCGGCAGGAG -3'
(R):5'- CAGTTGCAGGTGATTTTAAGATCC -3'
Posted On2016-08-04