Incidental Mutation 'R5380:Tnrc6b'
ID425823
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Nametrinucleotide repeat containing 6b
Synonyms
MMRRC Submission 042955-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R5380 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80711313-80941085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 80879565 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 423 (P423A)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067689
AA Change: P423A

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: P423A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228071
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228320
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik A T 4: 144,423,802 W70R probably damaging Het
Aco1 A T 4: 40,177,848 I290F probably damaging Het
Cmip T A 8: 117,422,890 C155S probably damaging Het
Cyba G T 8: 122,426,979 P82T possibly damaging Het
Dgkb C T 12: 38,127,300 R202W possibly damaging Het
Dnah6 T C 6: 73,037,615 E3611G probably damaging Het
Dnah7b A T 1: 46,217,191 S1885C probably benign Het
Dopey2 A G 16: 93,763,410 E748G probably damaging Het
Dusp18 C A 11: 3,897,037 P9Q probably damaging Het
Fat4 T A 3: 38,888,864 D635E probably damaging Het
Fbxo25 T A 8: 13,921,886 S79R probably benign Het
Fgfr4 T A 13: 55,167,417 L675Q probably damaging Het
Foxo1 T A 3: 52,269,025 L75Q probably damaging Het
Fsip2 T C 2: 82,975,398 V687A possibly damaging Het
Gga3 G T 11: 115,588,431 P354Q probably damaging Het
Gm11077 A T 6: 140,729,322 K13N unknown Het
Haus4 T A 14: 54,549,775 K75M probably damaging Het
Igfn1 G A 1: 135,966,087 T2085M probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lims1 A T 10: 58,416,670 I321L probably damaging Het
Ms4a6b A T 19: 11,521,680 I53F probably damaging Het
Msl3l2 A G 10: 56,115,572 D131G probably damaging Het
Nrap A G 19: 56,381,603 V189A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pfkl T G 10: 77,997,589 I260L possibly damaging Het
Pkd2l1 A G 19: 44,157,732 Y128H probably benign Het
Prpf6 T A 2: 181,608,266 L73Q probably damaging Het
R3hdm2 T C 10: 127,485,447 V658A probably damaging Het
Rab27b T C 18: 69,996,155 T23A probably damaging Het
Rabif A G 1: 134,506,242 E98G probably damaging Het
Ror2 T C 13: 53,117,149 D378G possibly damaging Het
Spata21 A G 4: 141,107,185 T494A probably damaging Het
Ssh2 A G 11: 77,453,945 K919E probably benign Het
Tomm40 A G 7: 19,701,750 F352L probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Tspo2 A G 17: 48,448,752 F93L probably benign Het
V1ra8 T A 6: 90,203,022 I69K probably damaging Het
Zan T C 5: 137,457,840 T1353A unknown Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp281 A G 1: 136,625,938 K218R possibly damaging Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 unclassified probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 unclassified probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7453:Tnrc6b UTSW 15 80902555 small deletion probably benign
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAGCATTGGTCCAAGAAG -3'
(R):5'- TTTCCAGAATTGCTTTGTCCAGAG -3'

Sequencing Primer
(F):5'- CATTGGAAACAGAAAGTAGTAGTTCC -3'
(R):5'- TCCAGAGACTGTGTCAGTTCCAG -3'
Posted On2016-08-04