Incidental Mutation 'R5380:Pkd2l1'
ID425828
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Namepolycystic kidney disease 2-like 1
SynonymsPCL, PKD2L, Pkdl, polycystin-L, TRPP3
MMRRC Submission 042955-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5380 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44147637-44192442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44157732 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 128 (Y128H)
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026]
Predicted Effect probably benign
Transcript: ENSMUST00000042026
AA Change: Y128H

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: Y128H

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161357
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik A T 4: 144,423,802 W70R probably damaging Het
Aco1 A T 4: 40,177,848 I290F probably damaging Het
Cmip T A 8: 117,422,890 C155S probably damaging Het
Cyba G T 8: 122,426,979 P82T possibly damaging Het
Dgkb C T 12: 38,127,300 R202W possibly damaging Het
Dnah6 T C 6: 73,037,615 E3611G probably damaging Het
Dnah7b A T 1: 46,217,191 S1885C probably benign Het
Dopey2 A G 16: 93,763,410 E748G probably damaging Het
Dusp18 C A 11: 3,897,037 P9Q probably damaging Het
Fat4 T A 3: 38,888,864 D635E probably damaging Het
Fbxo25 T A 8: 13,921,886 S79R probably benign Het
Fgfr4 T A 13: 55,167,417 L675Q probably damaging Het
Foxo1 T A 3: 52,269,025 L75Q probably damaging Het
Fsip2 T C 2: 82,975,398 V687A possibly damaging Het
Gga3 G T 11: 115,588,431 P354Q probably damaging Het
Gm11077 A T 6: 140,729,322 K13N unknown Het
Haus4 T A 14: 54,549,775 K75M probably damaging Het
Igfn1 G A 1: 135,966,087 T2085M probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lims1 A T 10: 58,416,670 I321L probably damaging Het
Ms4a6b A T 19: 11,521,680 I53F probably damaging Het
Msl3l2 A G 10: 56,115,572 D131G probably damaging Het
Nrap A G 19: 56,381,603 V189A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pfkl T G 10: 77,997,589 I260L possibly damaging Het
Prpf6 T A 2: 181,608,266 L73Q probably damaging Het
R3hdm2 T C 10: 127,485,447 V658A probably damaging Het
Rab27b T C 18: 69,996,155 T23A probably damaging Het
Rabif A G 1: 134,506,242 E98G probably damaging Het
Ror2 T C 13: 53,117,149 D378G possibly damaging Het
Spata21 A G 4: 141,107,185 T494A probably damaging Het
Ssh2 A G 11: 77,453,945 K919E probably benign Het
Tnrc6b C G 15: 80,879,565 P423A possibly damaging Het
Tomm40 A G 7: 19,701,750 F352L probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Tspo2 A G 17: 48,448,752 F93L probably benign Het
V1ra8 T A 6: 90,203,022 I69K probably damaging Het
Zan T C 5: 137,457,840 T1353A unknown Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp281 A G 1: 136,625,938 K218R possibly damaging Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44157636 critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44155605 missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44192279 utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44192196 missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44154223 missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44191442 missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44157268 missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44155536 missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44157631 splice site probably null
R0762:Pkd2l1 UTSW 19 44150470 missense probably benign 0.19
R0981:Pkd2l1 UTSW 19 44154422 critical splice donor site probably null
R1114:Pkd2l1 UTSW 19 44191544 splice site probably benign
R1381:Pkd2l1 UTSW 19 44150463 missense probably benign 0.08
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44155601 nonsense probably null
R2009:Pkd2l1 UTSW 19 44155964 missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44154500 missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44157269 missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3701:Pkd2l1 UTSW 19 44157227 missense probably damaging 0.99
R4179:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4180:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4617:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4618:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44155621 missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44153771 missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44154142 missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44149577 missense probably benign 0.00
R5480:Pkd2l1 UTSW 19 44192156 missense probably benign 0.18
R5950:Pkd2l1 UTSW 19 44152090 missense probably benign 0.27
R6248:Pkd2l1 UTSW 19 44157669 missense probably benign 0.00
R6908:Pkd2l1 UTSW 19 44152446 missense probably damaging 1.00
R6925:Pkd2l1 UTSW 19 44191508 missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44154208 missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44157690 missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44153715 missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44157229 missense probably benign 0.01
X0026:Pkd2l1 UTSW 19 44157182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCCCTGGTTCCAGACTG -3'
(R):5'- TTTCCCTAAAACATCTCCTGGAAC -3'

Sequencing Primer
(F):5'- GGTTCCAGACTGACCCTCTG -3'
(R):5'- TGGAACCCCTAGTGGTACCATC -3'
Posted On2016-08-04