Incidental Mutation 'R5391:Lpar1'
ID425837
Institutional Source Beutler Lab
Gene Symbol Lpar1
Ensembl Gene ENSMUSG00000038668
Gene Namelysophosphatidic acid receptor 1
SynonymsGpcr26, vzg-1, Kdt2, Edg2, LPA1
MMRRC Submission 042963-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5391 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58435255-58553898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58486902 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 105 (L105P)
Ref Sequence ENSEMBL: ENSMUSP00000103196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055018] [ENSMUST00000107570] [ENSMUST00000107571] [ENSMUST00000107574] [ENSMUST00000107575] [ENSMUST00000145361] [ENSMUST00000147354] [ENSMUST00000155170]
Predicted Effect probably benign
Transcript: ENSMUST00000055018
AA Change: L123P

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052581
Gene: ENSMUSG00000038668
AA Change: L123P

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 5.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107570
AA Change: L105P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103196
Gene: ENSMUSG00000038668
AA Change: L105P

DomainStartEndE-ValueType
Pfam:7tm_1 48 293 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107571
AA Change: L123P

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103197
Gene: ENSMUSG00000038668
AA Change: L123P

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107574
AA Change: L123P

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103200
Gene: ENSMUSG00000038668
AA Change: L123P

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107575
AA Change: L123P

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103201
Gene: ENSMUSG00000038668
AA Change: L123P

DomainStartEndE-ValueType
Pfam:7tm_1 66 311 1.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119701
Predicted Effect probably benign
Transcript: ENSMUST00000145361
Predicted Effect probably benign
Transcript: ENSMUST00000147354
Predicted Effect probably benign
Transcript: ENSMUST00000155170
SMART Domains Protein: ENSMUSP00000121440
Gene: ENSMUSG00000038668

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The integral membrane protein encoded by this gene is a lysophosphatidic acid (LPA) receptor from a group known as EDG receptors. These receptors are members of the G protein-coupled receptor superfamily. Utilized by LPA for cell signaling, EDG receptors mediate diverse biologic functions, including proliferation, platelet aggregation, smooth muscle contraction, inhibition of neuroblastoma cell differentiation, chemotaxis, and tumor cell invasion. Two transcript variants encoding the same protein have been identified for this gene [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations cause partial peri- and postnatal lethality, growth defects, craniofacial anomalies, and wide set eyes. Additional phenotypes include altered brain 5-HT and amino acids, reduced prepulse inhibition, impaired suckling, and increased apoptosis in sciatic nerve Schwann cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,805,481 M38I probably null Het
Actl7a A G 4: 56,743,661 T63A probably benign Het
Amfr G A 8: 93,976,048 P497S probably damaging Het
Ankrd33b T C 15: 31,325,206 I122V probably damaging Het
Asap1 G T 15: 64,094,052 T1011K possibly damaging Het
Cbfa2t3 G A 8: 122,633,395 R506* probably null Het
Ccdc105 G A 10: 78,752,854 Q41* probably null Het
Ccs C G 19: 4,833,482 C96S probably benign Het
Cpt1a A G 19: 3,349,260 D20G probably damaging Het
Ctdspl2 G A 2: 122,004,148 probably null Het
Dhx57 T C 17: 80,275,081 Y365C probably damaging Het
Dnah3 C T 7: 120,090,076 M38I probably benign Het
Dnajc6 T C 4: 101,628,158 probably null Het
Elac2 A G 11: 64,994,294 S450G probably benign Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Il12rb2 T C 6: 67,292,420 N803S probably benign Het
Itgb4 T A 11: 115,985,068 M477K probably benign Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Krt78 C A 15: 101,951,828 E218* probably null Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Mov10 G A 3: 104,802,533 H346Y probably benign Het
Nfia A G 4: 97,783,301 I83V probably damaging Het
Olfr1453 G T 19: 13,027,786 A181E probably damaging Het
Olfr215 T C 6: 116,582,847 Y33C probably damaging Het
Pcdhgb6 T G 18: 37,742,587 I116S probably damaging Het
Pdcd6ip G T 9: 113,691,518 Q133K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Pik3cd A T 4: 149,659,131 V207E probably damaging Het
Ptov1 T C 7: 44,863,584 Q397R probably damaging Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rasl12 G T 9: 65,398,667 A35S probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sec16a A G 2: 26,440,032 V657A possibly damaging Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Tbce T C 13: 14,005,965 I293M probably damaging Het
Tmem176a T C 6: 48,844,696 L204P probably damaging Het
Tmem87a A G 2: 120,362,877 probably null Het
Tns1 A T 1: 73,990,409 probably null Het
Usf3 T A 16: 44,217,463 S769T probably benign Het
Vmn2r82 A G 10: 79,356,657 T23A probably null Het
Vps26a A G 10: 62,456,747 *328Q probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wwc2 A T 8: 47,863,871 I729K unknown Het
Zbtb44 A G 9: 31,053,305 probably null Het
Zfp800 A T 6: 28,242,993 S658T probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zfp935 G T 13: 62,454,818 Y189* probably null Het
Zkscan1 T A 5: 138,097,101 H203Q probably benign Het
Zkscan14 T C 5: 145,195,794 D309G probably benign Het
Other mutations in Lpar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Lpar1 APN 4 58437407 missense probably damaging 1.00
bijou UTSW 4 58487155 missense possibly damaging 0.81
frenzied UTSW 4 58437346 missense possibly damaging 0.94
helper UTSW 4 58486875 missense possibly damaging 0.95
R0403:Lpar1 UTSW 4 58487191 missense probably damaging 1.00
R1793:Lpar1 UTSW 4 58486798 nonsense probably null
R2312:Lpar1 UTSW 4 58487168 nonsense probably null
R4279:Lpar1 UTSW 4 58487115 missense possibly damaging 0.73
R4762:Lpar1 UTSW 4 58437346 missense possibly damaging 0.94
R5500:Lpar1 UTSW 4 58486573 missense probably benign 0.26
R5619:Lpar1 UTSW 4 58487155 missense possibly damaging 0.81
R6208:Lpar1 UTSW 4 58504630 nonsense probably null
R6304:Lpar1 UTSW 4 58487013 missense probably damaging 1.00
R6464:Lpar1 UTSW 4 58486875 missense possibly damaging 0.95
R6593:Lpar1 UTSW 4 58486605 missense probably damaging 1.00
R7267:Lpar1 UTSW 4 58486857 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GATCGATATCACAGATGCAGTTCC -3'
(R):5'- GCGTGTTCATCATGTTGGCC -3'

Sequencing Primer
(F):5'- TGCAGTTCCAGCCCACACTG -3'
(R):5'- CCAATCTCCTGGTCATGGTGG -3'
Posted On2016-08-04