Incidental Mutation 'R5391:Olfr215'
ID425847
Institutional Source Beutler Lab
Gene Symbol Olfr215
Ensembl Gene ENSMUSG00000050654
Gene Nameolfactory receptor 215
SynonymsMOR119-2, GA_x54KRFPKN04-58217732-58216800
MMRRC Submission 042963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5391 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location116580084-116584195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116582847 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 33 (Y33C)
Ref Sequence ENSEMBL: ENSMUSP00000052425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061723]
Predicted Effect probably damaging
Transcript: ENSMUST00000061723
AA Change: Y33C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052425
Gene: ENSMUSG00000050654
AA Change: Y33C

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 258 1.8e-5 PFAM
Pfam:7tm_1 39 288 2.9e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,805,481 M38I probably null Het
Actl7a A G 4: 56,743,661 T63A probably benign Het
Amfr G A 8: 93,976,048 P497S probably damaging Het
Ankrd33b T C 15: 31,325,206 I122V probably damaging Het
Asap1 G T 15: 64,094,052 T1011K possibly damaging Het
Cbfa2t3 G A 8: 122,633,395 R506* probably null Het
Ccdc105 G A 10: 78,752,854 Q41* probably null Het
Ccs C G 19: 4,833,482 C96S probably benign Het
Cpt1a A G 19: 3,349,260 D20G probably damaging Het
Ctdspl2 G A 2: 122,004,148 probably null Het
Dhx57 T C 17: 80,275,081 Y365C probably damaging Het
Dnah3 C T 7: 120,090,076 M38I probably benign Het
Dnajc6 T C 4: 101,628,158 probably null Het
Elac2 A G 11: 64,994,294 S450G probably benign Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Il12rb2 T C 6: 67,292,420 N803S probably benign Het
Itgb4 T A 11: 115,985,068 M477K probably benign Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Krt78 C A 15: 101,951,828 E218* probably null Het
Lpar1 A G 4: 58,486,902 L105P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Mov10 G A 3: 104,802,533 H346Y probably benign Het
Nfia A G 4: 97,783,301 I83V probably damaging Het
Olfr1453 G T 19: 13,027,786 A181E probably damaging Het
Pcdhgb6 T G 18: 37,742,587 I116S probably damaging Het
Pdcd6ip G T 9: 113,691,518 Q133K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Pik3cd A T 4: 149,659,131 V207E probably damaging Het
Ptov1 T C 7: 44,863,584 Q397R probably damaging Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rasl12 G T 9: 65,398,667 A35S probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sec16a A G 2: 26,440,032 V657A possibly damaging Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Tbce T C 13: 14,005,965 I293M probably damaging Het
Tmem176a T C 6: 48,844,696 L204P probably damaging Het
Tmem87a A G 2: 120,362,877 probably null Het
Tns1 A T 1: 73,990,409 probably null Het
Usf3 T A 16: 44,217,463 S769T probably benign Het
Vmn2r82 A G 10: 79,356,657 T23A probably null Het
Vps26a A G 10: 62,456,747 *328Q probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wwc2 A T 8: 47,863,871 I729K unknown Het
Zbtb44 A G 9: 31,053,305 probably null Het
Zfp800 A T 6: 28,242,993 S658T probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zfp935 G T 13: 62,454,818 Y189* probably null Het
Zkscan1 T A 5: 138,097,101 H203Q probably benign Het
Zkscan14 T C 5: 145,195,794 D309G probably benign Het
Other mutations in Olfr215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Olfr215 APN 6 116582335 missense possibly damaging 0.93
IGL02959:Olfr215 APN 6 116582544 missense probably damaging 1.00
IGL03053:Olfr215 APN 6 116582245 missense possibly damaging 0.50
R0078:Olfr215 UTSW 6 116582740 missense probably damaging 0.96
R0277:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0323:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0399:Olfr215 UTSW 6 116582781 missense probably benign 0.00
R0545:Olfr215 UTSW 6 116582656 missense probably benign 0.01
R1213:Olfr215 UTSW 6 116582866 missense probably benign 0.00
R1775:Olfr215 UTSW 6 116582964 start gained probably benign
R1789:Olfr215 UTSW 6 116582697 missense probably damaging 1.00
R4724:Olfr215 UTSW 6 116582937 missense probably damaging 1.00
R5392:Olfr215 UTSW 6 116582418 missense probably damaging 1.00
R5686:Olfr215 UTSW 6 116582929 missense probably benign 0.00
R6124:Olfr215 UTSW 6 116582485 missense probably benign 0.05
R7080:Olfr215 UTSW 6 116582353 missense probably damaging 1.00
R7355:Olfr215 UTSW 6 116582955 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCGAATGCCCCGATAAATAGAG -3'
(R):5'- GAATGACCTCATTGTGTGCAC -3'

Sequencing Primer
(F):5'- AGGTTTGTATGAAACAGGCAAC -3'
(R):5'- GTGCACTGTGAGAATACCTCTGC -3'
Posted On2016-08-04