Incidental Mutation 'R5391:Amfr'
ID425854
Institutional Source Beutler Lab
Gene Symbol Amfr
Ensembl Gene ENSMUSG00000031751
Gene Nameautocrine motility factor receptor
Synonymsgp78
MMRRC Submission 042963-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R5391 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93971588-94012842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93976048 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 497 (P497S)
Ref Sequence ENSEMBL: ENSMUSP00000052258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053766]
Predicted Effect probably damaging
Transcript: ENSMUST00000053766
AA Change: P497S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052258
Gene: ENSMUSG00000031751
AA Change: P497S

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 141 158 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
RING 337 374 1.14e-8 SMART
CUE 452 493 3.3e-11 SMART
PDB:4LAD|B 571 596 2e-7 PDB
low complexity region 620 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139702
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice for a gene-trapped null allele are obese and develop liver steatosis and/or hepatic inflammation resembling nonalcoholic steatohepatitis. Some mice develop liver tumors. Mice homozygous for another knock-out allele exhibit normal HMGCR turnover in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,805,481 M38I probably null Het
Actl7a A G 4: 56,743,661 T63A probably benign Het
Ankrd33b T C 15: 31,325,206 I122V probably damaging Het
Asap1 G T 15: 64,094,052 T1011K possibly damaging Het
Cbfa2t3 G A 8: 122,633,395 R506* probably null Het
Ccdc105 G A 10: 78,752,854 Q41* probably null Het
Ccs C G 19: 4,833,482 C96S probably benign Het
Cpt1a A G 19: 3,349,260 D20G probably damaging Het
Ctdspl2 G A 2: 122,004,148 probably null Het
Dhx57 T C 17: 80,275,081 Y365C probably damaging Het
Dnah3 C T 7: 120,090,076 M38I probably benign Het
Dnajc6 T C 4: 101,628,158 probably null Het
Elac2 A G 11: 64,994,294 S450G probably benign Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Il12rb2 T C 6: 67,292,420 N803S probably benign Het
Itgb4 T A 11: 115,985,068 M477K probably benign Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Krt78 C A 15: 101,951,828 E218* probably null Het
Lpar1 A G 4: 58,486,902 L105P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Mov10 G A 3: 104,802,533 H346Y probably benign Het
Nfia A G 4: 97,783,301 I83V probably damaging Het
Olfr1453 G T 19: 13,027,786 A181E probably damaging Het
Olfr215 T C 6: 116,582,847 Y33C probably damaging Het
Pcdhgb6 T G 18: 37,742,587 I116S probably damaging Het
Pdcd6ip G T 9: 113,691,518 Q133K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Pik3cd A T 4: 149,659,131 V207E probably damaging Het
Ptov1 T C 7: 44,863,584 Q397R probably damaging Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rasl12 G T 9: 65,398,667 A35S probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sec16a A G 2: 26,440,032 V657A possibly damaging Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Tbce T C 13: 14,005,965 I293M probably damaging Het
Tmem176a T C 6: 48,844,696 L204P probably damaging Het
Tmem87a A G 2: 120,362,877 probably null Het
Tns1 A T 1: 73,990,409 probably null Het
Usf3 T A 16: 44,217,463 S769T probably benign Het
Vmn2r82 A G 10: 79,356,657 T23A probably null Het
Vps26a A G 10: 62,456,747 *328Q probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wwc2 A T 8: 47,863,871 I729K unknown Het
Zbtb44 A G 9: 31,053,305 probably null Het
Zfp800 A T 6: 28,242,993 S658T probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zfp935 G T 13: 62,454,818 Y189* probably null Het
Zkscan1 T A 5: 138,097,101 H203Q probably benign Het
Zkscan14 T C 5: 145,195,794 D309G probably benign Het
Other mutations in Amfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Amfr APN 8 93987508 critical splice acceptor site probably null
IGL02169:Amfr APN 8 94005230 splice site probably null
IGL03218:Amfr APN 8 94000336 missense probably damaging 0.97
FR4449:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4737:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4976:Amfr UTSW 8 94012292 unclassified probably benign
R0344:Amfr UTSW 8 93987370 splice site probably null
R0532:Amfr UTSW 8 93999108 missense probably damaging 1.00
R1056:Amfr UTSW 8 93985469 missense probably benign 0.27
R1295:Amfr UTSW 8 93974804 missense probably benign 0.26
R1386:Amfr UTSW 8 93985399 missense possibly damaging 0.58
R1450:Amfr UTSW 8 93987747 missense probably benign 0.45
R1613:Amfr UTSW 8 93999226 missense probably benign 0.00
R1703:Amfr UTSW 8 93974243 missense probably benign
R2857:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2858:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2859:Amfr UTSW 8 94005214 missense probably damaging 1.00
R3109:Amfr UTSW 8 94000306 missense probably damaging 1.00
R3708:Amfr UTSW 8 93983320 missense probably benign 0.05
R4456:Amfr UTSW 8 93984940 missense possibly damaging 0.80
R4600:Amfr UTSW 8 93974221 missense probably damaging 0.99
R4952:Amfr UTSW 8 93973159 unclassified probably benign
R5261:Amfr UTSW 8 93976170 critical splice acceptor site probably null
R5788:Amfr UTSW 8 94000314 missense probably damaging 1.00
R6238:Amfr UTSW 8 94000364 missense probably damaging 1.00
R6584:Amfr UTSW 8 93974155 missense probably benign 0.00
R6795:Amfr UTSW 8 94000333 missense probably benign 0.09
R6955:Amfr UTSW 8 94000376 missense probably damaging 1.00
R6978:Amfr UTSW 8 94000387 missense probably damaging 0.99
R7097:Amfr UTSW 8 94012009 missense probably benign 0.00
R7224:Amfr UTSW 8 93984856 missense probably damaging 1.00
R7260:Amfr UTSW 8 93976148 missense possibly damaging 0.80
R7289:Amfr UTSW 8 93999126 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATAGATGCCAGCCTCTGACAG -3'
(R):5'- CCTCAAATCTGCTGAGAGTGAC -3'

Sequencing Primer
(F):5'- CTCTGACAGGAGCCAATGG -3'
(R):5'- CAAATCTGCTGAGAGTGACCTTTGC -3'
Posted On2016-08-04