Incidental Mutation 'R5391:Ankrd33b'
ID425873
Institutional Source Beutler Lab
Gene Symbol Ankrd33b
Ensembl Gene ENSMUSG00000022237
Gene Nameankyrin repeat domain 33B
Synonyms
MMRRC Submission 042963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5391 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location31291478-31367726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31325206 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 122 (I122V)
Ref Sequence ENSEMBL: ENSMUSP00000117974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044324] [ENSMUST00000076942] [ENSMUST00000110410] [ENSMUST00000123325] [ENSMUST00000156679]
Predicted Effect probably benign
Transcript: ENSMUST00000044324
SMART Domains Protein: ENSMUSP00000037918
Gene: ENSMUSG00000022237

DomainStartEndE-ValueType
Blast:ANK 81 109 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000076942
SMART Domains Protein: ENSMUSP00000076209
Gene: ENSMUSG00000022237

DomainStartEndE-ValueType
Blast:ANK 81 109 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110410
AA Change: I113V

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106040
Gene: ENSMUSG00000022237
AA Change: I113V

DomainStartEndE-ValueType
Blast:ANK 81 106 5e-6 BLAST
ANK 107 137 2.32e2 SMART
ANK 141 170 8.86e-2 SMART
ANK 176 205 1.59e-3 SMART
ANK 210 240 1.27e3 SMART
low complexity region 363 382 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
coiled coil region 440 470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123325
AA Change: I122V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118984
Gene: ENSMUSG00000022237
AA Change: I122V

DomainStartEndE-ValueType
Blast:ANK 81 109 5e-9 BLAST
ANK 116 146 6.51e0 SMART
ANK 150 179 8.86e-2 SMART
ANK 185 214 1.59e-3 SMART
ANK 219 249 1.27e3 SMART
low complexity region 372 391 N/A INTRINSIC
low complexity region 397 419 N/A INTRINSIC
coiled coil region 449 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156679
AA Change: I122V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117974
Gene: ENSMUSG00000022237
AA Change: I122V

DomainStartEndE-ValueType
Blast:ANK 81 109 1e-9 BLAST
ANK 116 146 6.51e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227391
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,805,481 M38I probably null Het
Actl7a A G 4: 56,743,661 T63A probably benign Het
Amfr G A 8: 93,976,048 P497S probably damaging Het
Asap1 G T 15: 64,094,052 T1011K possibly damaging Het
Cbfa2t3 G A 8: 122,633,395 R506* probably null Het
Ccdc105 G A 10: 78,752,854 Q41* probably null Het
Ccs C G 19: 4,833,482 C96S probably benign Het
Cpt1a A G 19: 3,349,260 D20G probably damaging Het
Ctdspl2 G A 2: 122,004,148 probably null Het
Dhx57 T C 17: 80,275,081 Y365C probably damaging Het
Dnah3 C T 7: 120,090,076 M38I probably benign Het
Dnajc6 T C 4: 101,628,158 probably null Het
Elac2 A G 11: 64,994,294 S450G probably benign Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Il12rb2 T C 6: 67,292,420 N803S probably benign Het
Itgb4 T A 11: 115,985,068 M477K probably benign Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Krt78 C A 15: 101,951,828 E218* probably null Het
Lpar1 A G 4: 58,486,902 L105P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Mov10 G A 3: 104,802,533 H346Y probably benign Het
Nfia A G 4: 97,783,301 I83V probably damaging Het
Olfr1453 G T 19: 13,027,786 A181E probably damaging Het
Olfr215 T C 6: 116,582,847 Y33C probably damaging Het
Pcdhgb6 T G 18: 37,742,587 I116S probably damaging Het
Pdcd6ip G T 9: 113,691,518 Q133K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Pik3cd A T 4: 149,659,131 V207E probably damaging Het
Ptov1 T C 7: 44,863,584 Q397R probably damaging Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rasl12 G T 9: 65,398,667 A35S probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sec16a A G 2: 26,440,032 V657A possibly damaging Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Tbce T C 13: 14,005,965 I293M probably damaging Het
Tmem176a T C 6: 48,844,696 L204P probably damaging Het
Tmem87a A G 2: 120,362,877 probably null Het
Tns1 A T 1: 73,990,409 probably null Het
Usf3 T A 16: 44,217,463 S769T probably benign Het
Vmn2r82 A G 10: 79,356,657 T23A probably null Het
Vps26a A G 10: 62,456,747 *328Q probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wwc2 A T 8: 47,863,871 I729K unknown Het
Zbtb44 A G 9: 31,053,305 probably null Het
Zfp800 A T 6: 28,242,993 S658T probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zfp935 G T 13: 62,454,818 Y189* probably null Het
Zkscan1 T A 5: 138,097,101 H203Q probably benign Het
Zkscan14 T C 5: 145,195,794 D309G probably benign Het
Other mutations in Ankrd33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02031:Ankrd33b APN 15 31325183 missense probably damaging 1.00
IGL02074:Ankrd33b APN 15 31297661 missense probably damaging 1.00
IGL02120:Ankrd33b APN 15 31367056 missense possibly damaging 0.91
Opposition UTSW 15 31325085 critical splice donor site probably null
R0046:Ankrd33b UTSW 15 31367337 missense probably damaging 1.00
R0082:Ankrd33b UTSW 15 31297789 missense probably benign 0.00
R0357:Ankrd33b UTSW 15 31305126 missense probably benign 0.02
R0518:Ankrd33b UTSW 15 31367286 missense probably damaging 0.99
R0521:Ankrd33b UTSW 15 31367286 missense probably damaging 0.99
R1512:Ankrd33b UTSW 15 31367229 missense probably damaging 1.00
R1708:Ankrd33b UTSW 15 31305009 missense probably damaging 1.00
R1818:Ankrd33b UTSW 15 31367121 missense probably damaging 0.96
R2005:Ankrd33b UTSW 15 31297668 missense probably damaging 1.00
R4648:Ankrd33b UTSW 15 31325024 makesense probably null
R6292:Ankrd33b UTSW 15 31325085 critical splice donor site probably null
R6639:Ankrd33b UTSW 15 31297672 missense probably damaging 1.00
R7105:Ankrd33b UTSW 15 31305068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGAATCCATTTCCAGATCTG -3'
(R):5'- ACAGGTTGAAAACTGGGGCC -3'

Sequencing Primer
(F):5'- TCCAGATCTGTGGGATGCATCC -3'
(R):5'- CAGGAGCTGAGAGTTCTACATCTTC -3'
Posted On2016-08-04