Incidental Mutation 'R5391:Usf3'
ID425877
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
MMRRC Submission 042963-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R5391 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44217463 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 769 (S769T)
Ref Sequence ENSEMBL: ENSMUSP00000128627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088356] [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably benign
Transcript: ENSMUST00000088356
SMART Domains Protein: ENSMUSP00000085694
Gene: ENSMUSG00000068284

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119746
AA Change: S769T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: S769T

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141015
Predicted Effect probably benign
Transcript: ENSMUST00000169582
AA Change: S769T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: S769T

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,805,481 M38I probably null Het
Actl7a A G 4: 56,743,661 T63A probably benign Het
Amfr G A 8: 93,976,048 P497S probably damaging Het
Ankrd33b T C 15: 31,325,206 I122V probably damaging Het
Asap1 G T 15: 64,094,052 T1011K possibly damaging Het
Cbfa2t3 G A 8: 122,633,395 R506* probably null Het
Ccdc105 G A 10: 78,752,854 Q41* probably null Het
Ccs C G 19: 4,833,482 C96S probably benign Het
Cpt1a A G 19: 3,349,260 D20G probably damaging Het
Ctdspl2 G A 2: 122,004,148 probably null Het
Dhx57 T C 17: 80,275,081 Y365C probably damaging Het
Dnah3 C T 7: 120,090,076 M38I probably benign Het
Dnajc6 T C 4: 101,628,158 probably null Het
Elac2 A G 11: 64,994,294 S450G probably benign Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Il12rb2 T C 6: 67,292,420 N803S probably benign Het
Itgb4 T A 11: 115,985,068 M477K probably benign Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Krt78 C A 15: 101,951,828 E218* probably null Het
Lpar1 A G 4: 58,486,902 L105P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Mov10 G A 3: 104,802,533 H346Y probably benign Het
Nfia A G 4: 97,783,301 I83V probably damaging Het
Olfr1453 G T 19: 13,027,786 A181E probably damaging Het
Olfr215 T C 6: 116,582,847 Y33C probably damaging Het
Pcdhgb6 T G 18: 37,742,587 I116S probably damaging Het
Pdcd6ip G T 9: 113,691,518 Q133K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Pik3cd A T 4: 149,659,131 V207E probably damaging Het
Ptov1 T C 7: 44,863,584 Q397R probably damaging Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rasl12 G T 9: 65,398,667 A35S probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sec16a A G 2: 26,440,032 V657A possibly damaging Het
Sin3a G A 9: 57,105,673 R612H probably damaging Het
Six6 T A 12: 72,941,701 L216* probably null Het
Tbce T C 13: 14,005,965 I293M probably damaging Het
Tmem176a T C 6: 48,844,696 L204P probably damaging Het
Tmem87a A G 2: 120,362,877 probably null Het
Tns1 A T 1: 73,990,409 probably null Het
Vmn2r82 A G 10: 79,356,657 T23A probably null Het
Vps26a A G 10: 62,456,747 *328Q probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wwc2 A T 8: 47,863,871 I729K unknown Het
Zbtb44 A G 9: 31,053,305 probably null Het
Zfp800 A T 6: 28,242,993 S658T probably damaging Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zfp935 G T 13: 62,454,818 Y189* probably null Het
Zkscan1 T A 5: 138,097,101 H203Q probably benign Het
Zkscan14 T C 5: 145,195,794 D309G probably benign Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 unclassified probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
I1329:Usf3 UTSW 16 44220530 missense probably damaging 1.00
R0208:Usf3 UTSW 16 44216906 missense probably damaging 0.98
R0900:Usf3 UTSW 16 44215958 missense probably benign
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4024:Usf3 UTSW 16 44216165 missense possibly damaging 0.76
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGAATACATTTGGGGCTTTG -3'
(R):5'- ACTGCATGATGGCTCTGCTG -3'

Sequencing Primer
(F):5'- TTTGGCCAGCCTCAATCAAAG -3'
(R):5'- AGCTGTTTATTCTGGGGCCATCTATC -3'
Posted On2016-08-04