Incidental Mutation 'R5392:Mta1'
ID425917
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Namemetastasis associated 1
Synonyms
MMRRC Submission 042964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5392 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113098278-113137206 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113133236 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 559 (V559A)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]
Predicted Effect probably benign
Transcript: ENSMUST00000009099
AA Change: V559A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: V559A

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069690
AA Change: V542A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: V542A

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109723
AA Change: V559A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: V559A

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109726
AA Change: V542A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: V542A

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109727
AA Change: V559A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: V559A

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156030
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,010,168 probably null Het
Acyp1 T C 12: 85,278,985 probably benign Het
Ces1b G A 8: 93,071,962 R199C probably damaging Het
Col6a3 C A 1: 90,801,295 R1308L probably benign Het
Cpa5 C T 6: 30,630,830 Q364* probably null Het
Cyth4 T A 15: 78,606,985 L88Q probably damaging Het
Dock7 A G 4: 99,008,006 V59A probably damaging Het
Drd2 A G 9: 49,395,628 N5D possibly damaging Het
Epsti1 T C 14: 77,986,744 I272T probably benign Het
Fndc3b A T 3: 27,465,787 C568* probably null Het
Frmd4a C T 2: 4,594,573 A161V probably damaging Het
Gfpt1 A G 6: 87,077,157 T465A probably damaging Het
Hecw1 C A 13: 14,245,762 Q1025H probably damaging Het
Irak4 A T 15: 94,556,684 M237L probably benign Het
Irak4 T C 15: 94,556,685 M237T probably benign Het
Kdsr T A 1: 106,753,241 I76F possibly damaging Het
Kif15 T C 9: 122,996,295 F533S probably damaging Het
Kmt5b T C 19: 3,802,127 F103L possibly damaging Het
Krtcap2 C T 3: 89,246,879 L36F probably benign Het
Mroh7 A G 4: 106,711,251 probably null Het
N4bp1 A G 8: 86,860,420 probably null Het
Oas1d T C 5: 120,916,940 S192P possibly damaging Het
Olfr215 A G 6: 116,582,418 F176S probably damaging Het
Olfr353 T A 2: 36,890,674 Y58F probably benign Het
Olfr809 A G 10: 129,776,315 I149V probably benign Het
Rabgap1 T A 2: 37,469,489 N21K probably damaging Het
Rad9b A T 5: 122,351,578 C25S probably damaging Het
Spg7 T C 8: 123,087,363 S454P probably damaging Het
Spink2 T A 5: 77,207,025 H40L probably benign Het
Syne1 T A 10: 5,348,661 D1082V probably damaging Het
Syt2 A G 1: 134,744,021 D179G probably damaging Het
Tm7sf2 T C 19: 6,063,968 D181G probably damaging Het
Vmn1r174 A G 7: 23,754,802 I298V unknown Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vps9d1 T C 8: 123,254,013 E25G probably damaging Het
Zfp119a T C 17: 55,866,328 R172G probably benign Het
Zfp51 A T 17: 21,465,322 Y733F possibly damaging Het
Zfp658 A C 7: 43,572,931 E210A probably benign Het
Zp2 C A 7: 120,135,764 E433* probably null Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 intron probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CATAGGGCTGCTTCCTTCTG -3'
(R):5'- AATAAGAGTCACGTGGAGCTC -3'

Sequencing Primer
(F):5'- CCTTCTGGCCTAATCAATGGGG -3'
(R):5'- AGGCCTGGCTTCCTTCAAG -3'
Posted On2016-08-04