Incidental Mutation 'R5393:Tsc2'
ID425985
Institutional Source Beutler Lab
Gene Symbol Tsc2
Ensembl Gene ENSMUSG00000002496
Gene Nametuberous sclerosis 2
Synonymstuberin, Nafld
MMRRC Submission 042965-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5393 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24595816-24632630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24600396 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1251 (E1251G)
Ref Sequence ENSEMBL: ENSMUSP00000154706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000227804] [ENSMUST00000228412]
Predicted Effect probably benign
Transcript: ENSMUST00000035565
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097373
AA Change: E1252G

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: E1252G

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226284
AA Change: E1295G

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000226398
AA Change: E1252G

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227094
Predicted Effect probably benign
Transcript: ENSMUST00000227107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227432
Predicted Effect probably benign
Transcript: ENSMUST00000227607
AA Change: E1193G

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000227658
Predicted Effect possibly damaging
Transcript: ENSMUST00000227745
AA Change: E1318G

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000227804
Predicted Effect possibly damaging
Transcript: ENSMUST00000228412
AA Change: E1251G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228729
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik A T 16: 89,063,765 Y60* probably null Het
2810403A07Rik T A 3: 88,696,606 H243Q probably benign Het
Abca6 T A 11: 110,244,295 E221D probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adi1 A G 12: 28,675,275 D8G probably benign Het
Adnp T C 2: 168,182,949 K809E possibly damaging Het
Aldh18a1 T C 19: 40,585,567 H4R probably benign Het
Atp6v0a1 T C 11: 101,038,807 S485P possibly damaging Het
C1galt1 T C 6: 7,864,143 probably null Het
Cacna2d4 A T 6: 119,239,054 N94I probably benign Het
Catsperg1 T C 7: 29,185,499 N899S probably damaging Het
Coro2a A G 4: 46,542,255 S373P probably damaging Het
Cpsf6 G C 10: 117,362,016 probably benign Het
Csmd3 A T 15: 47,633,703 N3099K probably damaging Het
Ctla2b T A 13: 60,896,132 E74D probably damaging Het
Dnah2 T A 11: 69,500,857 T671S probably benign Het
Drd5 T A 5: 38,320,905 S414T probably benign Het
Dyrk2 C T 10: 118,859,848 D502N probably damaging Het
Ecel1 A T 1: 87,152,876 L376Q possibly damaging Het
Efcab8 G A 2: 153,780,983 R24Q unknown Het
Eloc A C 1: 16,647,968 probably benign Het
Ep300 A G 15: 81,631,618 probably benign Het
Fam89b T C 19: 5,728,705 D152G probably damaging Het
Gm15455 G A 1: 33,836,846 noncoding transcript Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Hdac10 T C 15: 89,126,684 Y238C probably damaging Het
Ick A G 9: 78,160,715 T463A probably benign Het
Ighv2-5 T C 12: 113,685,882 T12A possibly damaging Het
Insrr T C 3: 87,810,700 probably null Het
Irf9 T C 14: 55,606,457 probably benign Het
Itpr2 A T 6: 146,376,155 C280* probably null Het
Kcnk18 T C 19: 59,219,839 C36R probably damaging Het
Klhl14 G T 18: 21,651,994 N125K probably benign Het
Lce1i T C 3: 92,777,735 S45G unknown Het
Lrmda A C 14: 22,027,306 D37A probably damaging Het
Marco A C 1: 120,485,854 D280E probably damaging Het
Miox C T 15: 89,336,247 Q180* probably null Het
Npdc1 A T 2: 25,408,670 M265L probably damaging Het
Nudcd3 T C 11: 6,113,274 K205R probably damaging Het
Olfr319 T A 11: 58,702,500 H266Q probably damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Pcdhga5 C T 18: 37,696,667 R723C probably benign Het
Pdlim5 T A 3: 142,259,186 E295D probably damaging Het
Poli C A 18: 70,517,428 E314* probably null Het
Ptpro A G 6: 137,380,224 N238D probably benign Het
R3hdm1 A G 1: 128,231,347 I920V probably benign Het
Ralgapa2 C T 2: 146,345,455 V1338M probably damaging Het
Saa3 T C 7: 46,712,661 Y53C probably damaging Het
Sept14 T A 5: 129,683,586 E398D probably benign Het
Six3 T C 17: 85,623,842 S309P possibly damaging Het
Slc7a14 A G 3: 31,257,770 S34P probably damaging Het
Smarca2 C A 19: 26,640,429 Q287K probably benign Het
Stard9 C T 2: 120,702,906 L522F possibly damaging Het
Sycp1 T C 3: 102,841,047 probably null Het
Tbc1d8 A T 1: 39,426,088 V73E probably damaging Het
Tldc1 T C 8: 119,772,418 I112V probably benign Het
Tmem120a T C 5: 135,736,250 probably null Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt5b A C 6: 119,440,433 L157R probably damaging Het
Zbtb24 T A 10: 41,464,582 V536E probably damaging Het
Zfp593 G A 4: 134,245,304 A67V probably benign Het
Zfp995 A T 17: 21,880,492 F254I probably benign Het
Other mutations in Tsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tsc2 APN 17 24608107 missense probably damaging 1.00
IGL00985:Tsc2 APN 17 24597131 missense probably damaging 1.00
IGL01386:Tsc2 APN 17 24613285 missense probably damaging 1.00
IGL01468:Tsc2 APN 17 24621097 missense possibly damaging 0.90
IGL01530:Tsc2 APN 17 24622662 missense possibly damaging 0.76
IGL02390:Tsc2 APN 17 24600453 missense probably damaging 1.00
IGL02398:Tsc2 APN 17 24621729 missense probably damaging 1.00
IGL02741:Tsc2 APN 17 24629969 missense probably damaging 1.00
IGL03191:Tsc2 APN 17 24628054 missense probably damaging 1.00
IGL03372:Tsc2 APN 17 24619470 missense probably damaging 1.00
IGL03412:Tsc2 APN 17 24597068 missense probably damaging 0.98
Twitch UTSW 17 24596742 unclassified probably null
PIT4515001:Tsc2 UTSW 17 24621147 missense probably benign 0.15
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0138:Tsc2 UTSW 17 24599626 missense possibly damaging 0.65
R0540:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0570:Tsc2 UTSW 17 24626727 missense probably damaging 1.00
R0607:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0826:Tsc2 UTSW 17 24596958 missense probably benign 0.04
R1430:Tsc2 UTSW 17 24599023 critical splice donor site probably null
R1440:Tsc2 UTSW 17 24614392 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1541:Tsc2 UTSW 17 24631976 missense probably damaging 1.00
R1717:Tsc2 UTSW 17 24597068 missense probably damaging 0.98
R1799:Tsc2 UTSW 17 24604408 missense probably benign
R2030:Tsc2 UTSW 17 24623470 splice site probably benign
R2147:Tsc2 UTSW 17 24621142 missense possibly damaging 0.62
R2888:Tsc2 UTSW 17 24631995 critical splice donor site probably null
R3609:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3610:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3811:Tsc2 UTSW 17 24629037 missense probably benign 0.09
R3895:Tsc2 UTSW 17 24599812 missense probably damaging 1.00
R3962:Tsc2 UTSW 17 24621166 splice site probably benign
R3971:Tsc2 UTSW 17 24623588 missense probably damaging 1.00
R4018:Tsc2 UTSW 17 24625281 missense probably damaging 0.99
R4184:Tsc2 UTSW 17 24632016 missense probably benign 0.43
R4435:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4437:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4474:Tsc2 UTSW 17 24597264 missense probably damaging 0.98
R4703:Tsc2 UTSW 17 24604909 missense probably benign 0.13
R4731:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4732:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4733:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4817:Tsc2 UTSW 17 24596742 unclassified probably null
R4890:Tsc2 UTSW 17 24600035 missense probably damaging 1.00
R4922:Tsc2 UTSW 17 24600369 missense probably benign 0.22
R5119:Tsc2 UTSW 17 24603280 missense probably benign 0.00
R5785:Tsc2 UTSW 17 24599887 unclassified probably null
R5838:Tsc2 UTSW 17 24613216 missense probably benign 0.01
R5857:Tsc2 UTSW 17 24600007 missense probably damaging 0.99
R5911:Tsc2 UTSW 17 24600387 missense possibly damaging 0.63
R5988:Tsc2 UTSW 17 24620766 missense probably damaging 1.00
R6275:Tsc2 UTSW 17 24600420 missense probably benign 0.00
R6290:Tsc2 UTSW 17 24596910 missense probably benign 0.04
R6371:Tsc2 UTSW 17 24626714 missense probably benign 0.00
R6467:Tsc2 UTSW 17 24609127 missense probably benign 0.04
R6577:Tsc2 UTSW 17 24610499 missense probably damaging 1.00
R6728:Tsc2 UTSW 17 24621124 missense probably damaging 1.00
R6918:Tsc2 UTSW 17 24613229 missense probably damaging 1.00
R6995:Tsc2 UTSW 17 24628054 missense probably damaging 1.00
R7026:Tsc2 UTSW 17 24626739 missense probably damaging 0.99
R7136:Tsc2 UTSW 17 24613280 missense probably benign 0.00
R7236:Tsc2 UTSW 17 24623594 missense possibly damaging 0.82
R7243:Tsc2 UTSW 17 24599630 missense probably benign 0.02
R7249:Tsc2 UTSW 17 24607755 missense probably damaging 1.00
R7450:Tsc2 UTSW 17 24600031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAATGCCACCCAGATAGAGG -3'
(R):5'- CAGAGTTCATCTCAGCCTGC -3'

Sequencing Primer
(F):5'- CCCAGATAGAGGGTGAGAGACC -3'
(R):5'- ATCTCAGCCTGCTCCAGTGG -3'
Posted On2016-08-04