Incidental Mutation 'R5394:Shank1'
ID426042
Institutional Source Beutler Lab
Gene Symbol Shank1
Ensembl Gene ENSMUSG00000038738
Gene NameSH3 and multiple ankyrin repeat domains 1
Synonyms
MMRRC Submission 042966-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R5394 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44310253-44360572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44352651 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1257 (D1257N)
Ref Sequence ENSEMBL: ENSMUSP00000103568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107934] [ENSMUST00000107935] [ENSMUST00000107938]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107934
AA Change: D1256N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103567
Gene: ENSMUSG00000038738
AA Change: D1256N

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
PDZ 663 752 2.12e-13 SMART
Blast:PDZ 795 830 5e-11 BLAST
low complexity region 920 941 N/A INTRINSIC
low complexity region 955 982 N/A INTRINSIC
low complexity region 993 1023 N/A INTRINSIC
low complexity region 1051 1080 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
low complexity region 1179 1220 N/A INTRINSIC
low complexity region 1256 1275 N/A INTRINSIC
low complexity region 1298 1323 N/A INTRINSIC
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1369 1404 N/A INTRINSIC
low complexity region 1450 1466 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
low complexity region 1539 1555 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
low complexity region 1580 1614 N/A INTRINSIC
low complexity region 1633 1667 N/A INTRINSIC
low complexity region 1685 1720 N/A INTRINSIC
low complexity region 1735 1746 N/A INTRINSIC
low complexity region 1776 1787 N/A INTRINSIC
low complexity region 1806 1823 N/A INTRINSIC
low complexity region 1834 1852 N/A INTRINSIC
low complexity region 1893 1907 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
low complexity region 1942 1976 N/A INTRINSIC
low complexity region 1988 2004 N/A INTRINSIC
low complexity region 2009 2029 N/A INTRINSIC
low complexity region 2059 2083 N/A INTRINSIC
SAM 2092 2158 1.35e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107935
AA Change: D1257N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103568
Gene: ENSMUSG00000038738
AA Change: D1257N

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 796 831 1e-10 BLAST
low complexity region 921 942 N/A INTRINSIC
low complexity region 956 983 N/A INTRINSIC
low complexity region 994 1024 N/A INTRINSIC
low complexity region 1052 1081 N/A INTRINSIC
low complexity region 1124 1139 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
low complexity region 1180 1221 N/A INTRINSIC
low complexity region 1257 1276 N/A INTRINSIC
low complexity region 1299 1324 N/A INTRINSIC
low complexity region 1349 1360 N/A INTRINSIC
low complexity region 1370 1405 N/A INTRINSIC
low complexity region 1451 1467 N/A INTRINSIC
low complexity region 1513 1533 N/A INTRINSIC
low complexity region 1540 1556 N/A INTRINSIC
low complexity region 1558 1571 N/A INTRINSIC
low complexity region 1581 1615 N/A INTRINSIC
low complexity region 1634 1668 N/A INTRINSIC
low complexity region 1686 1721 N/A INTRINSIC
low complexity region 1736 1747 N/A INTRINSIC
low complexity region 1777 1788 N/A INTRINSIC
low complexity region 1807 1824 N/A INTRINSIC
low complexity region 1835 1853 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 1926 1937 N/A INTRINSIC
low complexity region 1943 1977 N/A INTRINSIC
low complexity region 1989 2005 N/A INTRINSIC
low complexity region 2010 2030 N/A INTRINSIC
low complexity region 2060 2084 N/A INTRINSIC
SAM 2093 2159 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107938
AA Change: D1265N
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738
AA Change: D1265N

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154776
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SHANK (SH3 domain and ankyrin repeat containing) family of proteins. Members of this family act as scaffold proteins that are required for the development and function of neuronal synapses. Deletions in this gene may be associated with autism spectrum disorder in males. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutation of this gene results in smaller pyramidal neuron dendritic spines, smaller and thinner postsynaptic density of central excitatory synapses, weaker synaptic transmission, increased anxiety-related behavior, and impaired contextual fearmemory, but enhanced spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,698 E226G probably damaging Het
4930503B20Rik A G 3: 146,650,608 F182L probably damaging Het
4930503B20Rik T C 3: 146,650,958 Y65C probably damaging Het
4930590J08Rik A G 6: 91,919,193 T341A probably benign Het
4932438A13Rik G T 3: 36,917,668 V517F probably damaging Het
Adamts13 G A 2: 26,986,558 V495I probably benign Het
Alms1 C A 6: 85,623,088 T2101K probably benign Het
Als2 T C 1: 59,174,946 D1361G probably benign Het
Ankdd1a A T 9: 65,505,214 M275K probably benign Het
Arfip2 A T 7: 105,636,976 Y161* probably null Het
Asap3 A T 4: 136,241,259 E707D probably benign Het
Atm C T 9: 53,507,777 probably null Het
Atp9b A T 18: 80,776,837 S577R probably benign Het
Camk1d G C 2: 5,303,366 D274E probably benign Het
Cebpz C T 17: 78,922,205 D907N probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnst T A 1: 179,601,736 probably benign Het
Cog2 G T 8: 124,532,529 V196L probably benign Het
Col11a1 A G 3: 114,194,184 probably null Het
Cops6 T A 5: 138,163,500 probably null Het
Cspg4 A G 9: 56,890,200 E1316G probably damaging Het
Cwc22 G C 2: 77,929,339 D122E possibly damaging Het
Dapk2 G A 9: 66,268,718 V300M probably benign Het
Dcp1b C A 6: 119,175,367 D25E probably damaging Het
Ddx10 A T 9: 53,233,857 Y273* probably null Het
Dhx58 T C 11: 100,698,208 E504G probably benign Het
Dync2h1 C T 9: 7,120,899 W2129* probably null Het
Egr4 A T 6: 85,512,460 L206Q probably damaging Het
Eif4g3 A G 4: 138,103,398 probably null Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fpr-rs3 T G 17: 20,624,208 M224L probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gxylt2 A G 6: 100,705,114 K91E probably benign Het
H2afy2 G A 10: 61,751,687 T156M possibly damaging Het
Hecw1 A T 13: 14,322,589 V278E probably damaging Het
Hydin A G 8: 110,539,842 probably null Het
Iars T C 13: 49,722,165 L776P probably damaging Het
Kcnh2 T A 5: 24,332,041 T182S probably benign Het
Lats2 T G 14: 57,691,353 S1022R probably benign Het
Lef1 C T 3: 131,194,659 P264S probably damaging Het
Lyrm1 A C 7: 119,914,248 I79L possibly damaging Het
Man2b2 T G 5: 36,814,518 Q618P probably benign Het
Mei1 T C 15: 82,092,756 V180A possibly damaging Het
Mmp15 A T 8: 95,366,404 N137I probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mut T A 17: 40,947,184 S414T probably benign Het
Myo18a T C 11: 77,853,350 M1846T probably benign Het
Neo1 A T 9: 58,990,234 N146K probably benign Het
Nos3 A G 5: 24,383,890 T1174A probably benign Het
Olfr1233 A T 2: 89,339,462 I280N probably damaging Het
Olfr417 T C 1: 174,369,270 Y118H probably damaging Het
Olfr566 A T 7: 102,856,479 S268T probably damaging Het
Olfr960 A T 9: 39,623,134 T4S probably benign Het
Pax8 A T 2: 24,442,910 probably benign Het
Pde5a G A 3: 122,818,009 C532Y probably damaging Het
Pigq T C 17: 25,931,472 D442G possibly damaging Het
Pik3c2g T C 6: 139,720,082 V43A probably benign Het
Pik3cb T C 9: 99,088,663 N325S probably benign Het
Pot1b T C 17: 55,700,063 K18R probably benign Het
Ppp1r42 A T 1: 9,999,405 L144Q probably damaging Het
Prdm13 T A 4: 21,679,455 Q345L unknown Het
Pyroxd2 T A 19: 42,740,459 K167N probably benign Het
Rnf123 T C 9: 108,070,731 Y131C probably damaging Het
Rnf25 T C 1: 74,595,252 D204G probably damaging Het
Rpf2 G A 10: 40,233,185 T60I possibly damaging Het
Scaf11 T C 15: 96,419,458 N742D probably benign Het
Shc2 A G 10: 79,630,099 V168A probably damaging Het
Slc16a4 G A 3: 107,292,442 V2M probably benign Het
Slc24a3 T C 2: 145,613,574 V461A probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc4a4 T A 5: 89,197,764 probably null Het
Snx30 T A 4: 59,879,329 D189E probably benign Het
Sspo A G 6: 48,495,260 Q4653R possibly damaging Het
Tpte G T 8: 22,327,790 R264I probably damaging Het
Tsc22d4 T A 5: 137,758,774 probably benign Het
Ubn1 T C 16: 5,074,369 L585P possibly damaging Het
Usp24 A T 4: 106,408,013 D1781V probably damaging Het
Utp20 A T 10: 88,772,915 Y1514* probably null Het
Vmn1r55 A T 7: 5,146,996 Y143N probably damaging Het
Vmn2r65 A G 7: 84,946,654 V274A probably benign Het
Wdr17 A G 8: 54,639,489 S1087P possibly damaging Het
Wnt5b C A 6: 119,440,322 R156L probably damaging Het
Zan T C 5: 137,435,634 D2279G unknown Het
Zan T C 5: 137,464,074 T948A unknown Het
Zfp758 T C 17: 22,372,068 S4P probably damaging Het
Zfp839 A G 12: 110,855,586 E278G probably benign Het
Zfp994 T A 17: 22,200,525 H481L probably damaging Het
Zswim9 G A 7: 13,260,983 R416C probably damaging Het
Other mutations in Shank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Shank1 APN 7 44354238 missense possibly damaging 0.89
IGL01293:Shank1 APN 7 44354236 missense possibly damaging 0.59
IGL01319:Shank1 APN 7 44353123 missense possibly damaging 0.93
IGL01347:Shank1 APN 7 44342120 missense unknown
IGL01621:Shank1 APN 7 44342465 missense unknown
IGL01621:Shank1 APN 7 44351599 missense unknown
IGL01964:Shank1 APN 7 44325678 missense unknown
IGL02309:Shank1 APN 7 44312842 missense unknown
IGL02325:Shank1 APN 7 44327080 nonsense probably null
IGL02387:Shank1 APN 7 44356937 missense possibly damaging 0.77
IGL02958:Shank1 APN 7 44354473 missense possibly damaging 0.59
R0098:Shank1 UTSW 7 44313285 missense unknown
R0098:Shank1 UTSW 7 44313285 missense unknown
R0197:Shank1 UTSW 7 44352294 missense unknown
R0326:Shank1 UTSW 7 44319170 missense unknown
R0365:Shank1 UTSW 7 44353977 missense possibly damaging 0.89
R0883:Shank1 UTSW 7 44352294 missense unknown
R1033:Shank1 UTSW 7 44356796 missense possibly damaging 0.77
R1390:Shank1 UTSW 7 44357038 missense probably damaging 1.00
R1453:Shank1 UTSW 7 44316075 missense unknown
R1594:Shank1 UTSW 7 44327223 nonsense probably null
R1713:Shank1 UTSW 7 44319737 missense unknown
R1783:Shank1 UTSW 7 44352737 missense possibly damaging 0.70
R1869:Shank1 UTSW 7 44342115 nonsense probably null
R1870:Shank1 UTSW 7 44342115 nonsense probably null
R1959:Shank1 UTSW 7 44325377 missense unknown
R1962:Shank1 UTSW 7 44344323 critical splice donor site probably null
R2406:Shank1 UTSW 7 44356952 missense possibly damaging 0.94
R2509:Shank1 UTSW 7 44351724 missense unknown
R2509:Shank1 UTSW 7 44352123 missense unknown
R3877:Shank1 UTSW 7 44344992 missense unknown
R4041:Shank1 UTSW 7 44342162 missense unknown
R4249:Shank1 UTSW 7 44319736 missense unknown
R4303:Shank1 UTSW 7 44342474 missense unknown
R4431:Shank1 UTSW 7 44319652 nonsense probably null
R4525:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4527:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4642:Shank1 UTSW 7 44313141 missense unknown
R4722:Shank1 UTSW 7 44313214 nonsense probably null
R4805:Shank1 UTSW 7 44343711 missense unknown
R4874:Shank1 UTSW 7 44316073 missense unknown
R4904:Shank1 UTSW 7 44334040 intron probably benign
R4939:Shank1 UTSW 7 44326162 missense unknown
R5410:Shank1 UTSW 7 44351822 missense unknown
R5556:Shank1 UTSW 7 44344315 intron probably benign
R5620:Shank1 UTSW 7 44312736 missense unknown
R5656:Shank1 UTSW 7 44352886 missense probably benign 0.33
R5688:Shank1 UTSW 7 44354487 missense possibly damaging 0.77
R5740:Shank1 UTSW 7 44353740 missense possibly damaging 0.89
R5801:Shank1 UTSW 7 44356816 missense possibly damaging 0.77
R6179:Shank1 UTSW 7 44357206 missense possibly damaging 0.58
R6186:Shank1 UTSW 7 44352566 missense probably benign 0.18
R6245:Shank1 UTSW 7 44352253 missense unknown
R6500:Shank1 UTSW 7 44327221 missense unknown
R6602:Shank1 UTSW 7 44352336 missense probably benign 0.03
R6655:Shank1 UTSW 7 44327220 missense unknown
R6709:Shank1 UTSW 7 44354176 missense probably benign 0.43
R6734:Shank1 UTSW 7 44353686 missense probably benign 0.01
R6881:Shank1 UTSW 7 44351793 missense unknown
R6902:Shank1 UTSW 7 44356815 missense probably benign 0.39
R6985:Shank1 UTSW 7 44344913 missense unknown
X0019:Shank1 UTSW 7 44356928 missense probably damaging 1.00
X0065:Shank1 UTSW 7 44351929 missense unknown
Z1088:Shank1 UTSW 7 44352166 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCTACCAGTAGCAGCGGCC -3'
(R):5'- TCCGAGGACTCCTTCAAGGC -3'

Sequencing Primer
(F):5'- AGGATCCTCGCCTAGCC -3'
(R):5'- AGGCGGGATCCAAGGCTTTG -3'
Posted On2016-08-04