Incidental Mutation 'R5394:Hydin'
ID426052
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
MMRRC Submission 042966-MU
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R5394 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 110539842 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
Predicted Effect probably null
Transcript: ENSMUST00000043141
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Meta Mutation Damage Score 0.6032 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (96/99)
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,698 E226G probably damaging Het
4930503B20Rik A G 3: 146,650,608 F182L probably damaging Het
4930503B20Rik T C 3: 146,650,958 Y65C probably damaging Het
4930590J08Rik A G 6: 91,919,193 T341A probably benign Het
4932438A13Rik G T 3: 36,917,668 V517F probably damaging Het
Adamts13 G A 2: 26,986,558 V495I probably benign Het
Alms1 C A 6: 85,623,088 T2101K probably benign Het
Als2 T C 1: 59,174,946 D1361G probably benign Het
Ankdd1a A T 9: 65,505,214 M275K probably benign Het
Arfip2 A T 7: 105,636,976 Y161* probably null Het
Asap3 A T 4: 136,241,259 E707D probably benign Het
Atm C T 9: 53,507,777 probably null Het
Atp9b A T 18: 80,776,837 S577R probably benign Het
Camk1d G C 2: 5,303,366 D274E probably benign Het
Cebpz C T 17: 78,922,205 D907N probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnst T A 1: 179,601,736 probably benign Het
Cog2 G T 8: 124,532,529 V196L probably benign Het
Col11a1 A G 3: 114,194,184 probably null Het
Cops6 T A 5: 138,163,500 probably null Het
Cspg4 A G 9: 56,890,200 E1316G probably damaging Het
Cwc22 G C 2: 77,929,339 D122E possibly damaging Het
Dapk2 G A 9: 66,268,718 V300M probably benign Het
Dcp1b C A 6: 119,175,367 D25E probably damaging Het
Ddx10 A T 9: 53,233,857 Y273* probably null Het
Dhx58 T C 11: 100,698,208 E504G probably benign Het
Dync2h1 C T 9: 7,120,899 W2129* probably null Het
Egr4 A T 6: 85,512,460 L206Q probably damaging Het
Eif4g3 A G 4: 138,103,398 probably null Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fpr-rs3 T G 17: 20,624,208 M224L probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gxylt2 A G 6: 100,705,114 K91E probably benign Het
H2afy2 G A 10: 61,751,687 T156M possibly damaging Het
Hecw1 A T 13: 14,322,589 V278E probably damaging Het
Iars T C 13: 49,722,165 L776P probably damaging Het
Kcnh2 T A 5: 24,332,041 T182S probably benign Het
Lats2 T G 14: 57,691,353 S1022R probably benign Het
Lef1 C T 3: 131,194,659 P264S probably damaging Het
Lyrm1 A C 7: 119,914,248 I79L possibly damaging Het
Man2b2 T G 5: 36,814,518 Q618P probably benign Het
Mei1 T C 15: 82,092,756 V180A possibly damaging Het
Mmp15 A T 8: 95,366,404 N137I probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mut T A 17: 40,947,184 S414T probably benign Het
Myo18a T C 11: 77,853,350 M1846T probably benign Het
Neo1 A T 9: 58,990,234 N146K probably benign Het
Nos3 A G 5: 24,383,890 T1174A probably benign Het
Olfr1233 A T 2: 89,339,462 I280N probably damaging Het
Olfr417 T C 1: 174,369,270 Y118H probably damaging Het
Olfr566 A T 7: 102,856,479 S268T probably damaging Het
Olfr960 A T 9: 39,623,134 T4S probably benign Het
Pax8 A T 2: 24,442,910 probably benign Het
Pde5a G A 3: 122,818,009 C532Y probably damaging Het
Pigq T C 17: 25,931,472 D442G possibly damaging Het
Pik3c2g T C 6: 139,720,082 V43A probably benign Het
Pik3cb T C 9: 99,088,663 N325S probably benign Het
Pot1b T C 17: 55,700,063 K18R probably benign Het
Ppp1r42 A T 1: 9,999,405 L144Q probably damaging Het
Prdm13 T A 4: 21,679,455 Q345L unknown Het
Pyroxd2 T A 19: 42,740,459 K167N probably benign Het
Rnf123 T C 9: 108,070,731 Y131C probably damaging Het
Rnf25 T C 1: 74,595,252 D204G probably damaging Het
Rpf2 G A 10: 40,233,185 T60I possibly damaging Het
Scaf11 T C 15: 96,419,458 N742D probably benign Het
Shank1 G A 7: 44,352,651 D1257N possibly damaging Het
Shc2 A G 10: 79,630,099 V168A probably damaging Het
Slc16a4 G A 3: 107,292,442 V2M probably benign Het
Slc24a3 T C 2: 145,613,574 V461A probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc4a4 T A 5: 89,197,764 probably null Het
Snx30 T A 4: 59,879,329 D189E probably benign Het
Sspo A G 6: 48,495,260 Q4653R possibly damaging Het
Tpte G T 8: 22,327,790 R264I probably damaging Het
Tsc22d4 T A 5: 137,758,774 probably benign Het
Ubn1 T C 16: 5,074,369 L585P possibly damaging Het
Usp24 A T 4: 106,408,013 D1781V probably damaging Het
Utp20 A T 10: 88,772,915 Y1514* probably null Het
Vmn1r55 A T 7: 5,146,996 Y143N probably damaging Het
Vmn2r65 A G 7: 84,946,654 V274A probably benign Het
Wdr17 A G 8: 54,639,489 S1087P possibly damaging Het
Wnt5b C A 6: 119,440,322 R156L probably damaging Het
Zan T C 5: 137,435,634 D2279G unknown Het
Zan T C 5: 137,464,074 T948A unknown Het
Zfp758 T C 17: 22,372,068 S4P probably damaging Het
Zfp839 A G 12: 110,855,586 E278G probably benign Het
Zfp994 T A 17: 22,200,525 H481L probably damaging Het
Zswim9 G A 7: 13,260,983 R416C probably damaging Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
franz_joseph UTSW 8 110601318 missense probably damaging 1.00
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4583:Hydin UTSW 8 110595225 missense probably benign 0.36
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAGACATGGGAGCCTTCAC -3'
(R):5'- AAGCCAAGTTGTCTGTGTGTC -3'

Sequencing Primer
(F):5'- TTGTAGGACACTGAACGCTG -3'
(R):5'- TCTGTGTGTCAGAGCAGAGAC -3'
Posted On2016-08-04