Incidental Mutation 'R5394:Atm'
ID426057
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
MMRRC Submission 042966-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R5394 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 53507777 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect probably null
Transcript: ENSMUST00000118282
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000232179
Meta Mutation Damage Score 0.506 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,698 E226G probably damaging Het
4930503B20Rik A G 3: 146,650,608 F182L probably damaging Het
4930503B20Rik T C 3: 146,650,958 Y65C probably damaging Het
4930590J08Rik A G 6: 91,919,193 T341A probably benign Het
4932438A13Rik G T 3: 36,917,668 V517F probably damaging Het
Adamts13 G A 2: 26,986,558 V495I probably benign Het
Alms1 C A 6: 85,623,088 T2101K probably benign Het
Als2 T C 1: 59,174,946 D1361G probably benign Het
Ankdd1a A T 9: 65,505,214 M275K probably benign Het
Arfip2 A T 7: 105,636,976 Y161* probably null Het
Asap3 A T 4: 136,241,259 E707D probably benign Het
Atp9b A T 18: 80,776,837 S577R probably benign Het
Camk1d G C 2: 5,303,366 D274E probably benign Het
Cebpz C T 17: 78,922,205 D907N probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnst T A 1: 179,601,736 probably benign Het
Cog2 G T 8: 124,532,529 V196L probably benign Het
Col11a1 A G 3: 114,194,184 probably null Het
Cops6 T A 5: 138,163,500 probably null Het
Cspg4 A G 9: 56,890,200 E1316G probably damaging Het
Cwc22 G C 2: 77,929,339 D122E possibly damaging Het
Dapk2 G A 9: 66,268,718 V300M probably benign Het
Dcp1b C A 6: 119,175,367 D25E probably damaging Het
Ddx10 A T 9: 53,233,857 Y273* probably null Het
Dhx58 T C 11: 100,698,208 E504G probably benign Het
Dync2h1 C T 9: 7,120,899 W2129* probably null Het
Egr4 A T 6: 85,512,460 L206Q probably damaging Het
Eif4g3 A G 4: 138,103,398 probably null Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fpr-rs3 T G 17: 20,624,208 M224L probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gxylt2 A G 6: 100,705,114 K91E probably benign Het
H2afy2 G A 10: 61,751,687 T156M possibly damaging Het
Hecw1 A T 13: 14,322,589 V278E probably damaging Het
Hydin A G 8: 110,539,842 probably null Het
Iars T C 13: 49,722,165 L776P probably damaging Het
Kcnh2 T A 5: 24,332,041 T182S probably benign Het
Lats2 T G 14: 57,691,353 S1022R probably benign Het
Lef1 C T 3: 131,194,659 P264S probably damaging Het
Lyrm1 A C 7: 119,914,248 I79L possibly damaging Het
Man2b2 T G 5: 36,814,518 Q618P probably benign Het
Mei1 T C 15: 82,092,756 V180A possibly damaging Het
Mmp15 A T 8: 95,366,404 N137I probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mut T A 17: 40,947,184 S414T probably benign Het
Myo18a T C 11: 77,853,350 M1846T probably benign Het
Neo1 A T 9: 58,990,234 N146K probably benign Het
Nos3 A G 5: 24,383,890 T1174A probably benign Het
Olfr1233 A T 2: 89,339,462 I280N probably damaging Het
Olfr417 T C 1: 174,369,270 Y118H probably damaging Het
Olfr566 A T 7: 102,856,479 S268T probably damaging Het
Olfr960 A T 9: 39,623,134 T4S probably benign Het
Pax8 A T 2: 24,442,910 probably benign Het
Pde5a G A 3: 122,818,009 C532Y probably damaging Het
Pigq T C 17: 25,931,472 D442G possibly damaging Het
Pik3c2g T C 6: 139,720,082 V43A probably benign Het
Pik3cb T C 9: 99,088,663 N325S probably benign Het
Pot1b T C 17: 55,700,063 K18R probably benign Het
Ppp1r42 A T 1: 9,999,405 L144Q probably damaging Het
Prdm13 T A 4: 21,679,455 Q345L unknown Het
Pyroxd2 T A 19: 42,740,459 K167N probably benign Het
Rnf123 T C 9: 108,070,731 Y131C probably damaging Het
Rnf25 T C 1: 74,595,252 D204G probably damaging Het
Rpf2 G A 10: 40,233,185 T60I possibly damaging Het
Scaf11 T C 15: 96,419,458 N742D probably benign Het
Shank1 G A 7: 44,352,651 D1257N possibly damaging Het
Shc2 A G 10: 79,630,099 V168A probably damaging Het
Slc16a4 G A 3: 107,292,442 V2M probably benign Het
Slc24a3 T C 2: 145,613,574 V461A probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc4a4 T A 5: 89,197,764 probably null Het
Snx30 T A 4: 59,879,329 D189E probably benign Het
Sspo A G 6: 48,495,260 Q4653R possibly damaging Het
Tpte G T 8: 22,327,790 R264I probably damaging Het
Tsc22d4 T A 5: 137,758,774 probably benign Het
Ubn1 T C 16: 5,074,369 L585P possibly damaging Het
Usp24 A T 4: 106,408,013 D1781V probably damaging Het
Utp20 A T 10: 88,772,915 Y1514* probably null Het
Vmn1r55 A T 7: 5,146,996 Y143N probably damaging Het
Vmn2r65 A G 7: 84,946,654 V274A probably benign Het
Wdr17 A G 8: 54,639,489 S1087P possibly damaging Het
Wnt5b C A 6: 119,440,322 R156L probably damaging Het
Zan T C 5: 137,435,634 D2279G unknown Het
Zan T C 5: 137,464,074 T948A unknown Het
Zfp758 T C 17: 22,372,068 S4P probably damaging Het
Zfp839 A G 12: 110,855,586 E278G probably benign Het
Zfp994 T A 17: 22,200,525 H481L probably damaging Het
Zswim9 G A 7: 13,260,983 R416C probably damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 unclassified probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
civil UTSW 9 53492268 missense possibly damaging 0.78
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
Strato UTSW 9 53503018 missense probably damaging 1.00
tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 intron probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 intron probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7487:Atm UTSW 9 53524354 missense probably benign
R7653:Atm UTSW 9 53490302 nonsense probably null
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCATCTATGCGTGCGTG -3'
(R):5'- CCAAGTCCCAGTTTCATATTCAG -3'

Sequencing Primer
(F):5'- CTATGCGTGCGTGCGTGC -3'
(R):5'- GCAATGCGAAGTTGTTATTTCAAC -3'
Posted On2016-08-04