Incidental Mutation 'R5394:Pyroxd2'
ID426088
Institutional Source Beutler Lab
Gene Symbol Pyroxd2
Ensembl Gene ENSMUSG00000060224
Gene Namepyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms
MMRRC Submission 042966-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5394 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location42725858-42752775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42740459 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 167 (K167N)
Ref Sequence ENSEMBL: ENSMUSP00000075825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076505]
Predicted Effect probably benign
Transcript: ENSMUST00000076505
AA Change: K167N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075825
Gene: ENSMUSG00000060224
AA Change: K167N

DomainStartEndE-ValueType
Pfam:NAD_binding_8 39 97 3.5e-11 PFAM
Pfam:Amino_oxidase 46 423 2.7e-15 PFAM
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (96/99)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,698 E226G probably damaging Het
4930503B20Rik A G 3: 146,650,608 F182L probably damaging Het
4930503B20Rik T C 3: 146,650,958 Y65C probably damaging Het
4930590J08Rik A G 6: 91,919,193 T341A probably benign Het
4932438A13Rik G T 3: 36,917,668 V517F probably damaging Het
Adamts13 G A 2: 26,986,558 V495I probably benign Het
Alms1 C A 6: 85,623,088 T2101K probably benign Het
Als2 T C 1: 59,174,946 D1361G probably benign Het
Ankdd1a A T 9: 65,505,214 M275K probably benign Het
Arfip2 A T 7: 105,636,976 Y161* probably null Het
Asap3 A T 4: 136,241,259 E707D probably benign Het
Atm C T 9: 53,507,777 probably null Het
Atp9b A T 18: 80,776,837 S577R probably benign Het
Camk1d G C 2: 5,303,366 D274E probably benign Het
Cebpz C T 17: 78,922,205 D907N probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnst T A 1: 179,601,736 probably benign Het
Cog2 G T 8: 124,532,529 V196L probably benign Het
Col11a1 A G 3: 114,194,184 probably null Het
Cops6 T A 5: 138,163,500 probably null Het
Cspg4 A G 9: 56,890,200 E1316G probably damaging Het
Cwc22 G C 2: 77,929,339 D122E possibly damaging Het
Dapk2 G A 9: 66,268,718 V300M probably benign Het
Dcp1b C A 6: 119,175,367 D25E probably damaging Het
Ddx10 A T 9: 53,233,857 Y273* probably null Het
Dhx58 T C 11: 100,698,208 E504G probably benign Het
Dync2h1 C T 9: 7,120,899 W2129* probably null Het
Egr4 A T 6: 85,512,460 L206Q probably damaging Het
Eif4g3 A G 4: 138,103,398 probably null Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fpr-rs3 T G 17: 20,624,208 M224L probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gxylt2 A G 6: 100,705,114 K91E probably benign Het
H2afy2 G A 10: 61,751,687 T156M possibly damaging Het
Hecw1 A T 13: 14,322,589 V278E probably damaging Het
Hydin A G 8: 110,539,842 probably null Het
Iars T C 13: 49,722,165 L776P probably damaging Het
Kcnh2 T A 5: 24,332,041 T182S probably benign Het
Lats2 T G 14: 57,691,353 S1022R probably benign Het
Lef1 C T 3: 131,194,659 P264S probably damaging Het
Lyrm1 A C 7: 119,914,248 I79L possibly damaging Het
Man2b2 T G 5: 36,814,518 Q618P probably benign Het
Mei1 T C 15: 82,092,756 V180A possibly damaging Het
Mmp15 A T 8: 95,366,404 N137I probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mut T A 17: 40,947,184 S414T probably benign Het
Myo18a T C 11: 77,853,350 M1846T probably benign Het
Neo1 A T 9: 58,990,234 N146K probably benign Het
Nos3 A G 5: 24,383,890 T1174A probably benign Het
Olfr1233 A T 2: 89,339,462 I280N probably damaging Het
Olfr417 T C 1: 174,369,270 Y118H probably damaging Het
Olfr566 A T 7: 102,856,479 S268T probably damaging Het
Olfr960 A T 9: 39,623,134 T4S probably benign Het
Pax8 A T 2: 24,442,910 probably benign Het
Pde5a G A 3: 122,818,009 C532Y probably damaging Het
Pigq T C 17: 25,931,472 D442G possibly damaging Het
Pik3c2g T C 6: 139,720,082 V43A probably benign Het
Pik3cb T C 9: 99,088,663 N325S probably benign Het
Pot1b T C 17: 55,700,063 K18R probably benign Het
Ppp1r42 A T 1: 9,999,405 L144Q probably damaging Het
Prdm13 T A 4: 21,679,455 Q345L unknown Het
Rnf123 T C 9: 108,070,731 Y131C probably damaging Het
Rnf25 T C 1: 74,595,252 D204G probably damaging Het
Rpf2 G A 10: 40,233,185 T60I possibly damaging Het
Scaf11 T C 15: 96,419,458 N742D probably benign Het
Shank1 G A 7: 44,352,651 D1257N possibly damaging Het
Shc2 A G 10: 79,630,099 V168A probably damaging Het
Slc16a4 G A 3: 107,292,442 V2M probably benign Het
Slc24a3 T C 2: 145,613,574 V461A probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc4a4 T A 5: 89,197,764 probably null Het
Snx30 T A 4: 59,879,329 D189E probably benign Het
Sspo A G 6: 48,495,260 Q4653R possibly damaging Het
Tpte G T 8: 22,327,790 R264I probably damaging Het
Tsc22d4 T A 5: 137,758,774 probably benign Het
Ubn1 T C 16: 5,074,369 L585P possibly damaging Het
Usp24 A T 4: 106,408,013 D1781V probably damaging Het
Utp20 A T 10: 88,772,915 Y1514* probably null Het
Vmn1r55 A T 7: 5,146,996 Y143N probably damaging Het
Vmn2r65 A G 7: 84,946,654 V274A probably benign Het
Wdr17 A G 8: 54,639,489 S1087P possibly damaging Het
Wnt5b C A 6: 119,440,322 R156L probably damaging Het
Zan T C 5: 137,435,634 D2279G unknown Het
Zan T C 5: 137,464,074 T948A unknown Het
Zfp758 T C 17: 22,372,068 S4P probably damaging Het
Zfp839 A G 12: 110,855,586 E278G probably benign Het
Zfp994 T A 17: 22,200,525 H481L probably damaging Het
Zswim9 G A 7: 13,260,983 R416C probably damaging Het
Other mutations in Pyroxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Pyroxd2 APN 19 42731438 missense possibly damaging 0.89
IGL01636:Pyroxd2 APN 19 42738332 missense probably benign 0.40
IGL02808:Pyroxd2 APN 19 42731342 missense probably benign
IGL02831:Pyroxd2 APN 19 42735903 missense probably damaging 0.99
IGL03179:Pyroxd2 APN 19 42747562 missense possibly damaging 0.89
R0360:Pyroxd2 UTSW 19 42747553 missense probably damaging 1.00
R0364:Pyroxd2 UTSW 19 42747553 missense probably damaging 1.00
R0567:Pyroxd2 UTSW 19 42735925 missense probably benign
R0690:Pyroxd2 UTSW 19 42727642 splice site probably benign
R0843:Pyroxd2 UTSW 19 42747547 missense probably damaging 1.00
R1649:Pyroxd2 UTSW 19 42738134 missense probably damaging 0.99
R2032:Pyroxd2 UTSW 19 42727649 splice site probably benign
R2087:Pyroxd2 UTSW 19 42733770 missense probably benign 0.00
R3040:Pyroxd2 UTSW 19 42735518 missense probably benign
R3898:Pyroxd2 UTSW 19 42740392 missense probably damaging 0.99
R4746:Pyroxd2 UTSW 19 42752400 nonsense probably null
R5634:Pyroxd2 UTSW 19 42740485 missense probably benign 0.21
R5977:Pyroxd2 UTSW 19 42735472 missense probably damaging 1.00
R6745:Pyroxd2 UTSW 19 42747360 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCCACAAAGGTCACTCCC -3'
(R):5'- ATGACATACAGACCTGGAGATG -3'

Sequencing Primer
(F):5'- CCACACCCTGATCCTTGGACTTTAG -3'
(R):5'- CTGAGCAGAGCCAAGCTG -3'
Posted On2016-08-04