Incidental Mutation 'R5395:Sin3a'
ID426128
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission 042967-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5395 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57105673 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 612 (R612H)
Ref Sequence ENSEMBL: ENSMUSP00000126601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
Predicted Effect probably damaging
Transcript: ENSMUST00000049169
AA Change: R612H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: R612H

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125333
Predicted Effect probably damaging
Transcript: ENSMUST00000167715
AA Change: R612H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: R612H

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168177
AA Change: R612H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: R612H

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168502
AA Change: R612H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: R612H

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168678
AA Change: R612H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: R612H

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,080,941 I268V probably benign Het
Actn1 T A 12: 80,170,703 I782F probably benign Het
Adamdec1 A C 14: 68,570,903 S333A probably benign Het
Agbl5 C A 5: 30,890,338 T58N probably damaging Het
Apoo-ps T A 13: 107,414,493 noncoding transcript Het
Arhgef10l T C 4: 140,570,290 N277S probably benign Het
Ascc2 A G 11: 4,659,273 E241G possibly damaging Het
Atp13a4 A T 16: 29,420,888 Y835* probably null Het
Atp13a4 A G 16: 29,456,604 V354A possibly damaging Het
Bcas3 T C 11: 85,825,249 S426P probably damaging Het
Birc3 T C 9: 7,861,174 R48G probably damaging Het
Cacna2d4 T C 6: 119,271,418 S397P possibly damaging Het
Ccng2 T C 5: 93,269,398 M91T possibly damaging Het
Clk3 G A 9: 57,753,339 T473M probably damaging Het
Cog2 T A 8: 124,545,221 H491Q probably benign Het
Cyp4f40 C T 17: 32,669,853 T202I probably benign Het
Dennd1a A T 2: 37,802,128 F181I probably damaging Het
Fcrl6 G T 1: 172,598,720 A170D possibly damaging Het
Fev T C 1: 74,882,664 probably null Het
Flnb A G 14: 7,883,881 N369S probably benign Het
Flt3 A G 5: 147,354,823 F606L probably damaging Het
Gdf9 T C 11: 53,433,797 V131A probably benign Het
Gdnf T A 15: 7,834,684 L192Q probably damaging Het
Gjc2 A T 11: 59,177,489 C56S possibly damaging Het
Gli3 T C 13: 15,714,950 F550L probably damaging Het
Gm1110 T C 9: 26,889,632 E422G probably benign Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gnb2 A G 5: 137,528,526 S334P probably damaging Het
Icam2 A T 11: 106,382,473 probably null Het
Inca1 C T 11: 70,690,438 probably null Het
Itgb8 A C 12: 119,170,741 C530W probably damaging Het
Lrp1 T C 10: 127,595,297 D332G probably damaging Het
Ly75 A T 2: 60,365,111 N234K probably benign Het
Mcm5 G A 8: 75,123,026 S542N probably benign Het
Mcm9 A T 10: 53,538,692 N97K possibly damaging Het
Morc2a G A 11: 3,688,232 R986H possibly damaging Het
Neu2 T A 1: 87,596,675 probably null Het
Nfatc1 G A 18: 80,636,020 P718S possibly damaging Het
Nol6 G A 4: 41,118,392 probably benign Het
Olfr1406 A T 1: 173,183,680 Y251* probably null Het
Otogl T C 10: 107,817,138 N1118D probably benign Het
Pcdh15 T A 10: 74,185,287 I111K probably damaging Het
Phkb A G 8: 86,017,468 D582G probably damaging Het
Piwil2 G T 14: 70,395,397 N575K probably benign Het
Pou4f2 T A 8: 78,435,072 I301F probably damaging Het
Prkd1 T C 12: 50,391,432 N409S probably damaging Het
Ptpn21 T G 12: 98,715,117 K86T probably damaging Het
Raly T A 2: 154,864,007 probably null Het
Rangap1 A G 15: 81,706,446 F482L probably benign Het
Rapgef1 T A 2: 29,737,965 N1052K probably damaging Het
Rnf169 A T 7: 99,935,160 probably null Het
Sdr16c5 T C 4: 4,016,277 S50G probably benign Het
Six6 T A 12: 72,941,701 L216* probably null Het
Slc20a1 A T 2: 129,208,337 N472Y probably damaging Het
Slc35d1 C T 4: 103,211,375 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slc7a8 C A 14: 54,733,277 G306* probably null Het
Slc9a8 T A 2: 167,467,722 F335L probably damaging Het
Smyd1 T G 6: 71,219,390 K338T possibly damaging Het
Snd1 T A 6: 28,526,184 V187E probably damaging Het
Spag9 T G 11: 94,091,751 probably null Het
Tnfsf9 C A 17: 57,105,592 T54K probably benign Het
Trim24 T G 6: 37,957,744 V798G probably damaging Het
Tyr C A 7: 87,472,490 A365S probably damaging Het
Usp43 T A 11: 67,897,358 probably null Het
Vmn2r55 T C 7: 12,651,947 D702G probably damaging Het
Vmn2r72 A G 7: 85,750,897 S315P possibly damaging Het
Wdr64 T A 1: 175,755,598 F367I probably damaging Het
Zc3h7b G A 15: 81,772,501 R173K possibly damaging Het
Zfp493 T A 13: 67,783,846 C21* probably null Het
Zfp825 T C 13: 74,480,546 T284A possibly damaging Het
Zpbp2 T A 11: 98,558,213 V275D probably damaging Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
PIT4519001:Sin3a UTSW 9 57095456 missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R1993:Sin3a UTSW 9 57101199 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2079:Sin3a UTSW 9 57089523 missense probably benign
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4327:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R4979:Sin3a UTSW 9 57118076 missense probably damaging 1.00
R5018:Sin3a UTSW 9 57110891 missense probably benign 0.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5927:Sin3a UTSW 9 57111111 missense probably damaging 1.00
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense probably null 1.00
R7285:Sin3a UTSW 9 57127299 missense possibly damaging 0.57
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAATTTAAAGTTTGGGCTAATGC -3'
(R):5'- TCCCAGCTACGACCTTTACAG -3'

Sequencing Primer
(F):5'- GGGCTAATGCTAGTTGATTTTTCCCC -3'
(R):5'- CCAGCTACGACCTTTACAGTTTAAG -3'
Posted On2016-08-04