Incidental Mutation 'R4778:Dpysl3'
ID426216
Institutional Source Beutler Lab
Gene Symbol Dpysl3
Ensembl Gene ENSMUSG00000024501
Gene Namedihydropyrimidinase-like 3
SynonymsTUC4, Ulip, Ulip1, CRMP-4
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location43320979-43438286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43354802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 159 (V159I)
Ref Sequence ENSEMBL: ENSMUSP00000113711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025379] [ENSMUST00000118043] [ENSMUST00000121805]
Predicted Effect probably benign
Transcript: ENSMUST00000025379
AA Change: V161I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025379
Gene: ENSMUSG00000024501
AA Change: V161I

DomainStartEndE-ValueType
Pfam:Amidohydro_5 35 104 8e-13 PFAM
Pfam:Amidohydro_4 59 410 3.4e-14 PFAM
Pfam:Amidohydro_1 64 413 7.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118043
AA Change: V159I

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113711
Gene: ENSMUSG00000024501
AA Change: V159I

DomainStartEndE-ValueType
Pfam:Amidohydro_5 33 102 2e-13 PFAM
Pfam:Amidohydro_4 57 408 8.8e-15 PFAM
Pfam:Amidohydro_1 62 411 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121805
AA Change: V274I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112928
Gene: ENSMUSG00000024501
AA Change: V274I

DomainStartEndE-ValueType
low complexity region 85 102 N/A INTRINSIC
Pfam:Amidohydro_1 177 566 1.4e-41 PFAM
Pfam:Amidohydro_3 481 566 1.2e-9 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the TUC (TOAD-64/Ulip/CRMP) family of proteins. Members of this family are phosphoproteins that function in axonal guidance and neuronal differentiation during development and regeneration of the nervous system. A mutation in the human gene is associated with amyotrophic lateral sclerosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired axon extension, abnormal neuron growth cones morphology and impaired anterograde transportation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Dpysl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Dpysl3 APN 18 43358300 missense probably damaging 1.00
IGL02533:Dpysl3 APN 18 43325794 missense probably benign 0.00
IGL02632:Dpysl3 APN 18 43393025 missense possibly damaging 0.50
IGL03111:Dpysl3 APN 18 43329845 missense probably damaging 1.00
IGL03138:Dpysl3 UTSW 18 43325794 missense probably benign 0.00
R0001:Dpysl3 UTSW 18 43358375 missense possibly damaging 0.93
R0062:Dpysl3 UTSW 18 43333876 splice site probably null
R0062:Dpysl3 UTSW 18 43333876 splice site probably null
R0656:Dpysl3 UTSW 18 43438071 missense possibly damaging 0.65
R1522:Dpysl3 UTSW 18 43363557 missense probably damaging 1.00
R1694:Dpysl3 UTSW 18 43328374 missense possibly damaging 0.94
R1764:Dpysl3 UTSW 18 43363518 missense probably damaging 1.00
R1822:Dpysl3 UTSW 18 43342328 missense probably benign 0.07
R1880:Dpysl3 UTSW 18 43329874 splice site probably null
R1907:Dpysl3 UTSW 18 43438128 missense probably damaging 1.00
R1925:Dpysl3 UTSW 18 43332931 missense probably damaging 1.00
R2248:Dpysl3 UTSW 18 43358293 missense possibly damaging 0.56
R3434:Dpysl3 UTSW 18 43361061 missense probably benign 0.01
R4575:Dpysl3 UTSW 18 43342247 missense probably damaging 1.00
R4780:Dpysl3 UTSW 18 43354802 missense probably benign 0.06
R4858:Dpysl3 UTSW 18 43334014 missense probably damaging 0.96
R4987:Dpysl3 UTSW 18 43328427 missense probably benign 0.00
R5151:Dpysl3 UTSW 18 43438080 missense probably benign 0.00
R5152:Dpysl3 UTSW 18 43438080 missense probably benign 0.00
R5229:Dpysl3 UTSW 18 43332951 missense probably damaging 1.00
R5373:Dpysl3 UTSW 18 43361036 missense probably damaging 1.00
R5374:Dpysl3 UTSW 18 43361036 missense probably damaging 1.00
R5383:Dpysl3 UTSW 18 43438038 missense probably damaging 1.00
R6014:Dpysl3 UTSW 18 43361067 missense probably damaging 1.00
R6837:Dpysl3 UTSW 18 43437882 missense probably benign 0.01
R6958:Dpysl3 UTSW 18 43438002 missense probably benign
R6991:Dpysl3 UTSW 18 43353891 missense probably damaging 1.00
R7087:Dpysl3 UTSW 18 43363530 missense probably damaging 1.00
R7196:Dpysl3 UTSW 18 43329845 missense probably damaging 1.00
R7223:Dpysl3 UTSW 18 43438042 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGTCTTCAATATACAACCTGGCAC -3'
(R):5'- GGGAGACACCATTCTGTCAAGAC -3'

Sequencing Primer
(F):5'- TGGCACAGTGACCTCCCAC -3'
(R):5'- CACCATTCTGTCAAGACACTATTTAC -3'
Posted On2016-08-25