Incidental Mutation 'R4731:Ptprb'
ID426243
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 042021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4731 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116319333 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 664 (V664A)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: V377A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: V377A

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217925
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: V664A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
AI413582 A G 17: 27,565,270 probably benign Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Akap9 T A 5: 3,962,266 S990T possibly damaging Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Anxa2 A T 9: 69,486,530 M217L probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
Btaf1 A G 19: 36,981,078 D665G probably benign Het
Ccdc36 A G 9: 108,405,385 V368A probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cfap74 T A 4: 155,463,602 probably benign Het
Chd1 A T 17: 17,377,817 E55D probably benign Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec9a G T 6: 129,416,336 A108S probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col9a3 G A 2: 180,610,681 E373K probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Ercc4 A T 16: 13,147,607 H701L probably damaging Het
Ern1 A T 11: 106,434,850 probably benign Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
Evc T A 5: 37,323,797 M235L probably benign Het
Fbxw22 T C 9: 109,378,869 I445V probably benign Het
Fmnl2 A G 2: 53,117,069 T764A possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr83 A G 9: 14,866,174 probably benign Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Helb T C 10: 120,094,288 probably null Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Ifit1bl1 T C 19: 34,594,321 I245M probably benign Het
Igdcc3 A G 9: 65,181,997 T492A probably damaging Het
Ighv13-1 T C 12: 114,267,632 probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Llgl1 T A 11: 60,706,225 L194* probably null Het
Map3k12 G T 15: 102,501,282 T686N probably benign Het
Myo18a C A 11: 77,829,759 P741Q probably benign Het
Ncaph2 G A 15: 89,355,827 probably benign Het
Nfkb2 A G 19: 46,308,964 Q406R possibly damaging Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr874 A T 9: 37,746,535 T134S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Ostm1 C T 10: 42,678,979 probably benign Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Phc2 C T 4: 128,707,971 T73M probably damaging Het
Pkp4 G A 2: 59,334,932 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Plk5 A T 10: 80,358,797 H118L probably damaging Het
Pnlip T C 19: 58,676,487 I249T probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Ros1 A C 10: 52,142,229 W778G probably damaging Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Samd4b G A 7: 28,406,663 R377W probably benign Het
Selenoo A G 15: 89,099,328 Q524R probably benign Het
Slc30a3 T C 5: 31,093,294 S22G probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc5a8 T C 10: 88,925,787 probably null Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slfn1 A T 11: 83,121,835 E259V probably damaging Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Sptbn2 T A 19: 4,742,480 F1388I probably damaging Het
Stac2 C T 11: 98,039,695 G349E probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trank1 T C 9: 111,390,410 F2072L probably damaging Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Trpc7 A G 13: 56,804,553 S541P probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Tspoap1 T A 11: 87,765,647 V257E probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ubr7 A G 12: 102,769,226 T315A probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Utp20 T C 10: 88,754,520 D2364G possibly damaging Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zfhx3 A G 8: 108,956,084 Q3385R unknown Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp738 A T 13: 67,669,914 C653S probably damaging Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAGAGACTGCATAACTTTCCCC -3'
(R):5'- AGGCATAGTGCGTTTCTTCC -3'

Sequencing Primer
(F):5'- TCACATGTCTTCAAAATGGGGG -3'
(R):5'- CCTTTCCCACTGTGGTGTTGAG -3'
Posted On2016-08-30