Incidental Mutation 'R5407:Tbc1d7'
ID426347
Institutional Source Beutler Lab
Gene Symbol Tbc1d7
Ensembl Gene ENSMUSG00000021368
Gene NameTBC1 domain family, member 7
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R5407 (G1)
Quality Score201
Status Not validated
Chromosome13
Chromosomal Location43151740-43171501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43154702 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 96 (S96A)
Ref Sequence ENSEMBL: ENSMUSP00000152737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021797] [ENSMUST00000179852] [ENSMUST00000220787] [ENSMUST00000221352] [ENSMUST00000221795] [ENSMUST00000222160] [ENSMUST00000223000]
Predicted Effect probably benign
Transcript: ENSMUST00000021797
AA Change: S218A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021797
Gene: ENSMUSG00000021368
AA Change: S218A

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 2.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179852
AA Change: S218A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137280
Gene: ENSMUSG00000021368
AA Change: S218A

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 5.5e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000220579
AA Change: S60A
Predicted Effect probably benign
Transcript: ENSMUST00000220787
AA Change: S218A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000221352
Predicted Effect probably benign
Transcript: ENSMUST00000221795
Predicted Effect probably benign
Transcript: ENSMUST00000222160
AA Change: S218A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223000
AA Change: S96A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A C 12: 55,566,196 Y302S probably damaging Het
Arpp21 G T 9: 112,116,753 probably benign Het
Camk1g C T 1: 193,347,372 probably null Het
Cand2 G A 6: 115,785,200 V196I possibly damaging Het
Cdc25b T A 2: 131,193,647 L381Q probably damaging Het
Col17a1 C T 19: 47,666,507 G610E probably damaging Het
Col19a1 C T 1: 24,303,494 E797K probably damaging Het
Col3a1 A T 1: 45,346,052 I110L probably benign Het
Col5a2 T A 1: 45,406,280 D506V possibly damaging Het
Crp A T 1: 172,698,109 probably null Het
Esco1 G T 18: 10,574,886 H729N probably damaging Het
Evx2 A G 2: 74,657,826 S217P probably damaging Het
Gabrb1 T C 5: 72,122,021 V303A possibly damaging Het
Gcnt3 A G 9: 70,034,189 Y366H probably benign Het
Gm436 T C 4: 144,670,325 K279R probably benign Het
Gmpr2 A G 14: 55,678,276 T304A possibly damaging Het
Golga3 C T 5: 110,201,990 Q656* probably null Het
Gramd1b T A 9: 40,455,655 M6L probably damaging Het
Kif17 T C 4: 138,298,221 Y945H probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lrrk1 T A 7: 66,270,797 Q1486L probably benign Het
Mboat7 G T 7: 3,691,381 H72N probably damaging Het
Med12l G A 3: 59,258,201 V1447M probably damaging Het
Mrpl3 T C 9: 105,077,095 F333L probably benign Het
Nav3 T C 10: 109,866,935 T246A probably benign Het
Neil3 A T 8: 53,601,019 V325E probably benign Het
Nlrp4g A T 9: 124,349,930 noncoding transcript Het
Olfr148 A T 9: 39,613,695 I43F probably damaging Het
Onecut1 C T 9: 74,889,456 S419F probably damaging Het
Ptp4a1 A T 1: 30,944,963 V58E probably benign Het
Radil C T 5: 142,508,215 R49H probably damaging Het
Ralgapa1 T C 12: 55,676,797 E1648G possibly damaging Het
Rnft2 C T 5: 118,242,502 M13I probably damaging Het
Satb2 A G 1: 56,948,150 L92P probably damaging Het
Scn4a T C 11: 106,320,889 Y1434C probably damaging Het
Setx T A 2: 29,145,474 M657K probably benign Het
Shd A G 17: 55,973,936 E204G probably damaging Het
Shh T A 5: 28,466,580 R62* probably null Het
Slc9a4 A G 1: 40,607,794 T483A probably benign Het
Tfcp2 T C 15: 100,527,874 probably null Het
Tlk2 T A 11: 105,240,375 S182R probably damaging Het
Tppp2 A G 14: 51,919,498 probably null Het
Trim65 T C 11: 116,126,080 T519A probably benign Het
Trio T C 15: 27,844,806 probably null Het
Usf3 G A 16: 44,217,406 V750I probably benign Het
Utrn T A 10: 12,680,625 K1480N probably damaging Het
Vmn1r58 T A 7: 5,410,873 R119S probably benign Het
Xirp2 A G 2: 67,510,969 I1185V probably benign Het
Zc3h7b A G 15: 81,785,891 H654R probably damaging Het
Zfyve16 G T 13: 92,500,284 A1306E probably damaging Het
Other mutations in Tbc1d7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Tbc1d7 APN 13 43159321 missense probably damaging 1.00
IGL01460:Tbc1d7 APN 13 43165359 missense probably benign 0.00
IGL02653:Tbc1d7 APN 13 43165398 missense probably benign
IGL03046:Tbc1d7 APN 13 43154686 splice site probably null
R0165:Tbc1d7 UTSW 13 43153202 splice site probably null
R0427:Tbc1d7 UTSW 13 43153087 missense probably benign 0.01
R0863:Tbc1d7 UTSW 13 43154685 splice site probably benign
R0930:Tbc1d7 UTSW 13 43165336 nonsense probably null
R1181:Tbc1d7 UTSW 13 43153139 missense probably damaging 1.00
R1792:Tbc1d7 UTSW 13 43165377 missense probably benign
R2113:Tbc1d7 UTSW 13 43153086 missense probably damaging 0.99
R4354:Tbc1d7 UTSW 13 43169868 missense probably damaging 1.00
R4743:Tbc1d7 UTSW 13 43169849 missense probably damaging 1.00
R6049:Tbc1d7 UTSW 13 43159360 missense probably damaging 0.99
R6320:Tbc1d7 UTSW 13 43152933 unclassified probably benign
R7024:Tbc1d7 UTSW 13 43154735 missense probably damaging 1.00
R7241:Tbc1d7 UTSW 13 43153017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CAGAGGCCCACAATCTTCCTAG -3'
(R):5'- TTGCAGCGTGAAGTGACATTATG -3'

Sequencing Primer
(F):5'- CAATCTTCCTAGGCATGTAGTCAAC -3'
(R):5'- TATGTTACAGGAAACGAGTGCTCAC -3'
Posted On2016-09-01