Incidental Mutation 'R5408:Pcyox1'
ID426386
Institutional Source Beutler Lab
Gene Symbol Pcyox1
Ensembl Gene ENSMUSG00000029998
Gene Nameprenylcysteine oxidase 1
Synonyms1200015P13Rik, Pcly, PCL1
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86386006-86397154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86392298 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 113 (L113S)
Ref Sequence ENSEMBL: ENSMUSP00000119449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032065] [ENSMUST00000153723] [ENSMUST00000204116]
Predicted Effect probably damaging
Transcript: ENSMUST00000032065
AA Change: L182S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032065
Gene: ENSMUSG00000029998
AA Change: L182S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 8.2e-13 PFAM
Pfam:Amino_oxidase 44 346 7.1e-9 PFAM
Pfam:Prenylcys_lyase 128 501 8.1e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129650
Predicted Effect unknown
Transcript: ENSMUST00000131500
AA Change: L15S
SMART Domains Protein: ENSMUSP00000122602
Gene: ENSMUSG00000029998
AA Change: L15S

DomainStartEndE-ValueType
Pfam:Prenylcys_lyase 1 73 6.1e-25 PFAM
Pfam:Prenylcys_lyase 69 197 7.1e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153723
AA Change: L113S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119449
Gene: ENSMUSG00000029998
AA Change: L113S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Prenylcys_lyase 59 181 5.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203960
Predicted Effect probably benign
Transcript: ENSMUST00000204116
SMART Domains Protein: ENSMUSP00000145474
Gene: ENSMUSG00000029998

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 4.9e-12 PFAM
Pfam:Amino_oxidase 44 136 3.3e-7 PFAM
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product (Tschantz et al., 1999 [PubMed 10585463]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious pathology despite a striking accumulation of both farnesylcysteine and geranylgeranylcysteine in brain and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Pcyox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Pcyox1 APN 6 86388753 missense probably damaging 1.00
IGL02008:Pcyox1 APN 6 86392268 missense probably benign 0.01
IGL02655:Pcyox1 APN 6 86389344 missense probably damaging 1.00
R0690:Pcyox1 UTSW 6 86394442 missense probably damaging 1.00
R4631:Pcyox1 UTSW 6 86389143 missense probably benign 0.00
R4631:Pcyox1 UTSW 6 86389230 missense possibly damaging 0.96
R4976:Pcyox1 UTSW 6 86388726 missense probably damaging 1.00
R5227:Pcyox1 UTSW 6 86391744 missense probably damaging 0.98
R5288:Pcyox1 UTSW 6 86392354 splice site probably null
R5862:Pcyox1 UTSW 6 86391674 critical splice donor site probably null
R6002:Pcyox1 UTSW 6 86392182 missense probably benign 0.02
R6123:Pcyox1 UTSW 6 86388928 missense possibly damaging 0.88
R6290:Pcyox1 UTSW 6 86388899 missense probably benign 0.24
R6766:Pcyox1 UTSW 6 86394408 critical splice donor site probably null
R7047:Pcyox1 UTSW 6 86388909 missense probably damaging 1.00
R7066:Pcyox1 UTSW 6 86394496 missense probably damaging 1.00
R7139:Pcyox1 UTSW 6 86394537 missense possibly damaging 0.50
R7268:Pcyox1 UTSW 6 86391731 missense possibly damaging 0.69
R7445:Pcyox1 UTSW 6 86391679 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCCCGAGACACTAAGAACTAG -3'
(R):5'- ATTTCACTGTGTATCCCAGGG -3'

Sequencing Primer
(F):5'- GACTACGGCTAGCTCGGATTTC -3'
(R):5'- GGGTGTCCTACAATTTGCAAAGCC -3'
Posted On2016-09-01