Incidental Mutation 'R5408:Mmp3'
ID426399
Institutional Source Beutler Lab
Gene Symbol Mmp3
Ensembl Gene ENSMUSG00000043613
Gene Namematrix metallopeptidase 3
SynonymsStmy1, Str1, stromelysin 1, SLN-1, stromelysin-1, STR-1, progelatinase, SLN1
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7445822-7455975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7449904 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 263 (S263P)
Ref Sequence ENSEMBL: ENSMUSP00000034497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034497]
Predicted Effect probably damaging
Transcript: ENSMUST00000034497
AA Change: S263P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034497
Gene: ENSMUSG00000043613
AA Change: S263P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 29 89 1.7e-12 PFAM
ZnMc 107 267 6.24e-65 SMART
HX 298 340 4.56e-9 SMART
HX 342 385 2.87e-6 SMART
HX 390 437 4.73e-16 SMART
HX 439 479 3.3e-6 SMART
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded protein is activated by the removal of an N-temrinal activation peptide to generate a zinc-dependent endopeptidase with a broad range of substrates such as proteoglycans, laminin, fibronectin, elastin, and collagens. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disrutptions in this gene display abnormalities of the immune system as well as minor structural abnormalities in the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Mmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mmp3 APN 9 7445894 utr 5 prime probably benign
IGL01738:Mmp3 APN 9 7446946 missense possibly damaging 0.94
IGL02154:Mmp3 APN 9 7453662 missense probably benign 0.19
IGL02212:Mmp3 APN 9 7450165 missense probably damaging 1.00
IGL02568:Mmp3 APN 9 7446001 missense probably benign 0.02
IGL03366:Mmp3 APN 9 7450149 missense probably benign 0.00
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0356:Mmp3 UTSW 9 7451768 missense probably benign 0.03
R0390:Mmp3 UTSW 9 7451320 missense probably benign 0.29
R0401:Mmp3 UTSW 9 7449790 missense probably damaging 1.00
R0466:Mmp3 UTSW 9 7450165 missense probably damaging 1.00
R0549:Mmp3 UTSW 9 7455638 missense probably benign 0.08
R0903:Mmp3 UTSW 9 7445994 missense probably benign 0.00
R1438:Mmp3 UTSW 9 7453705 missense probably benign 0.22
R1498:Mmp3 UTSW 9 7446967 missense possibly damaging 0.95
R1515:Mmp3 UTSW 9 7451232 missense probably benign 0.01
R1629:Mmp3 UTSW 9 7447641 missense probably benign 0.00
R1844:Mmp3 UTSW 9 7453662 missense probably benign 0.19
R1858:Mmp3 UTSW 9 7451799 missense probably benign 0.08
R2099:Mmp3 UTSW 9 7453672 missense probably benign 0.01
R2497:Mmp3 UTSW 9 7450131 missense probably benign 0.00
R2571:Mmp3 UTSW 9 7451844 missense possibly damaging 0.95
R4659:Mmp3 UTSW 9 7453673 missense probably benign 0.00
R4687:Mmp3 UTSW 9 7451223 missense probably benign 0.03
R4717:Mmp3 UTSW 9 7449881 missense possibly damaging 0.94
R4930:Mmp3 UTSW 9 7447640 missense probably benign 0.02
R4932:Mmp3 UTSW 9 7446994 missense probably benign 0.00
R5020:Mmp3 UTSW 9 7445984 missense probably benign
R5384:Mmp3 UTSW 9 7451759 nonsense probably null
R5385:Mmp3 UTSW 9 7451759 nonsense probably null
R6268:Mmp3 UTSW 9 7447622 missense possibly damaging 0.78
R7317:Mmp3 UTSW 9 7446937 missense probably damaging 1.00
R7467:Mmp3 UTSW 9 7447621 missense possibly damaging 0.93
R7467:Mmp3 UTSW 9 7450125 missense probably benign 0.07
X0022:Mmp3 UTSW 9 7449857 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATGCAATGCCCAACTTGCC -3'
(R):5'- ATGCTGTGGGAGTTCCTAAAGG -3'

Sequencing Primer
(F):5'- ATGCAATGCCCAACTTGCCTATATG -3'
(R):5'- CCTAAAGGGAACAGATTAAAAGAGGC -3'
Posted On2016-09-01