Incidental Mutation 'R5408:Mpo'
ID426408
Institutional Source Beutler Lab
Gene Symbol Mpo
Ensembl Gene ENSMUSG00000009350
Gene Namemyeloperoxidase
Synonyms
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87793581-87804413 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 87801025 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020779] [ENSMUST00000107930] [ENSMUST00000121303] [ENSMUST00000143021] [ENSMUST00000146650]
Predicted Effect probably null
Transcript: ENSMUST00000020779
SMART Domains Protein: ENSMUSP00000020779
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107930
SMART Domains Protein: ENSMUSP00000103563
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
SCOP:g1cxp.1 82 99 1e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121303
SMART Domains Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130442
Predicted Effect probably benign
Transcript: ENSMUST00000143021
SMART Domains Protein: ENSMUSP00000123371
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:4C1M|B 139 167 4e-11 PDB
SCOP:g1cxp.1 141 167 4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146650
SMART Domains Protein: ENSMUSP00000128484
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
Pfam:An_peroxidase 1 112 2.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167903
Meta Mutation Damage Score 0.6548 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of neutrophils. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes neutrophil dysfunction and decreased resistance to fungal infection with Candida, and may lead to enhanced atherosclerosis, reduced neutrophil-mediated lysis of muscle cells, decreased resistance to EAE, and altered asbestos-induced lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Mpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Mpo APN 11 87802617 missense probably benign
IGL00668:Mpo APN 11 87797334 missense probably benign 0.01
IGL01016:Mpo APN 11 87797610 unclassified probably null
IGL01517:Mpo APN 11 87795821 missense possibly damaging 0.83
IGL01530:Mpo APN 11 87801191 missense probably benign 0.00
IGL02123:Mpo APN 11 87794795 missense probably benign 0.05
R0091:Mpo UTSW 11 87801610 missense probably benign 0.06
R0458:Mpo UTSW 11 87796297 missense probably benign 0.35
R0506:Mpo UTSW 11 87803504 missense probably benign 0.00
R0574:Mpo UTSW 11 87796076 missense probably damaging 0.99
R0850:Mpo UTSW 11 87797502 missense probably damaging 1.00
R1488:Mpo UTSW 11 87797430 missense probably damaging 1.00
R1753:Mpo UTSW 11 87795881 missense probably benign 0.06
R1785:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R1891:Mpo UTSW 11 87801280 nonsense probably null
R1989:Mpo UTSW 11 87803472 missense probably damaging 1.00
R2107:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2108:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2130:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R2132:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R3930:Mpo UTSW 11 87801040 missense probably damaging 1.00
R3931:Mpo UTSW 11 87801040 missense probably damaging 1.00
R3941:Mpo UTSW 11 87797349 missense probably benign 0.02
R4323:Mpo UTSW 11 87796039 missense probably damaging 1.00
R4857:Mpo UTSW 11 87796281 missense probably benign
R4892:Mpo UTSW 11 87802681 missense probably benign 0.00
R5224:Mpo UTSW 11 87796457 unclassified probably benign
R5250:Mpo UTSW 11 87803433 missense probably benign 0.03
R5373:Mpo UTSW 11 87803611 critical splice donor site probably null
R5374:Mpo UTSW 11 87803611 critical splice donor site probably null
R5708:Mpo UTSW 11 87801755 splice site probably null
R6354:Mpo UTSW 11 87797346 missense possibly damaging 0.89
R6598:Mpo UTSW 11 87799972 missense probably benign 0.43
R6713:Mpo UTSW 11 87795368 missense probably damaging 1.00
R7053:Mpo UTSW 11 87803510 missense probably damaging 0.99
R7395:Mpo UTSW 11 87801124 missense probably damaging 1.00
Z1088:Mpo UTSW 11 87795245 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTCAAGGGGAAATGGGACC -3'
(R):5'- AAGACCTTGCTGAGTGGGAC -3'

Sequencing Primer
(F):5'- TACCTTAAAGACACGGGGGATATTAC -3'
(R):5'- GGGCCGGTACTGATTGTTC -3'
Posted On2016-09-01