Incidental Mutation 'R5409:Clca4b'
ID426437
Institutional Source Beutler Lab
Gene Symbol Clca4b
Ensembl Gene ENSMUSG00000074195
Gene Namechloride channel accessory 4B
SynonymsAI747448
MMRRC Submission 042978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5409 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location144910921-144932529 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 144916691 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 538 (K538*)
Ref Sequence ENSEMBL: ENSMUSP00000096149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098549]
Predicted Effect probably null
Transcript: ENSMUST00000098549
AA Change: K538*
SMART Domains Protein: ENSMUSP00000096149
Gene: ENSMUSG00000074195
AA Change: K538*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 306 480 1.03e-15 SMART
Blast:VWA 513 552 6e-16 BLAST
Blast:FN3 757 838 5e-35 BLAST
low complexity region 882 906 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozyogus mutant null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,014,320 L2002P probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl1 A G 8: 83,929,742 T230A probably damaging Het
Anapc4 A G 5: 52,848,599 E316G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Aurka T G 2: 172,367,116 Q33P possibly damaging Het
Cenpm T C 15: 82,234,363 T153A probably benign Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Col5a1 C T 2: 27,960,445 T518I unknown Het
Dis3 A T 14: 99,085,932 M566K possibly damaging Het
Dnah1 C T 14: 31,263,255 R3869H probably damaging Het
Gm4775 A T 14: 106,100,952 noncoding transcript Het
Gm7075 A T 10: 63,421,624 M39K possibly damaging Het
Hipk2 C T 6: 38,730,042 G637D probably damaging Het
Igkv4-61 T C 6: 69,417,127 K18E possibly damaging Het
Kcnk4 A G 19: 6,926,210 S324P probably benign Het
Larp4 T C 15: 99,986,064 C61R probably damaging Het
Nid2 T C 14: 19,805,962 F986L probably damaging Het
Olfr1107 T C 2: 87,071,870 E88G possibly damaging Het
Olfr190 C T 16: 59,074,196 V295I possibly damaging Het
Olfr198 A G 16: 59,201,557 Y290H probably damaging Het
Pgbd5 T A 8: 124,371,880 I359F probably damaging Het
Plekhh2 T C 17: 84,586,478 probably null Het
Pomgnt2 A T 9: 121,982,237 S493T possibly damaging Het
Rp1l1 T C 14: 64,030,621 S1219P probably benign Het
Rprd1b T A 2: 158,075,067 F322L probably damaging Het
Sh3rf1 G A 8: 61,374,245 V678M probably benign Het
Smpd5 C A 15: 76,295,714 T321K probably damaging Het
Spag8 T A 4: 43,653,134 probably benign Het
Tanc2 T C 11: 105,867,485 C691R possibly damaging Het
Tnc A C 4: 63,966,536 M1834R probably damaging Het
Tnc A T 4: 64,007,417 Y961N probably damaging Het
Ttn T C 2: 76,870,549 probably benign Het
Ufl1 A G 4: 25,280,706 V47A probably damaging Het
Unc13c T A 9: 73,578,390 D1676V possibly damaging Het
Vmn1r65 T C 7: 6,009,013 N74S possibly damaging Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Wisp2 G A 2: 163,825,238 C53Y probably damaging Het
Other mutations in Clca4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Clca4b APN 3 144932391 missense probably benign 0.00
IGL00391:Clca4b APN 3 144915561 missense possibly damaging 0.81
IGL00576:Clca4b APN 3 144925347 missense probably damaging 1.00
IGL01484:Clca4b APN 3 144928235 missense probably benign 0.02
IGL01539:Clca4b APN 3 144926157 missense probably benign
IGL01726:Clca4b APN 3 144928342 missense probably damaging 1.00
IGL01903:Clca4b APN 3 144928259 missense probably damaging 0.98
IGL01967:Clca4b APN 3 144928190 splice site probably benign
IGL02002:Clca4b APN 3 144932433 missense probably benign 0.00
IGL02323:Clca4b APN 3 144913321 missense probably benign
IGL02379:Clca4b APN 3 144921858 missense probably benign 0.00
IGL02638:Clca4b APN 3 144926178 missense probably damaging 1.00
IGL02859:Clca4b APN 3 144912039 missense probably benign
R0110:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0266:Clca4b UTSW 3 144922786 missense probably damaging 1.00
R0311:Clca4b UTSW 3 144932496 missense probably benign 0.04
R0348:Clca4b UTSW 3 144921980 missense probably damaging 0.96
R0450:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0510:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0538:Clca4b UTSW 3 144921956 missense probably benign 0.15
R0551:Clca4b UTSW 3 144928626 missense probably damaging 1.00
R0552:Clca4b UTSW 3 144916775 missense probably benign
R0570:Clca4b UTSW 3 144925349 missense probably benign 0.01
R0591:Clca4b UTSW 3 144915592 nonsense probably null
R0627:Clca4b UTSW 3 144928259 missense probably benign 0.20
R0729:Clca4b UTSW 3 144928350 splice site probably benign
R0844:Clca4b UTSW 3 144916771 missense probably damaging 0.96
R0964:Clca4b UTSW 3 144915576 missense probably benign
R1388:Clca4b UTSW 3 144916654 missense probably benign
R1479:Clca4b UTSW 3 144915468 missense probably damaging 0.99
R1603:Clca4b UTSW 3 144922019 missense probably benign 0.20
R2045:Clca4b UTSW 3 144925163 missense probably damaging 1.00
R2162:Clca4b UTSW 3 144928587 missense probably benign 0.19
R2185:Clca4b UTSW 3 144928556 missense probably damaging 1.00
R2241:Clca4b UTSW 3 144911226 missense probably benign 0.00
R2300:Clca4b UTSW 3 144916671 missense probably benign 0.02
R2321:Clca4b UTSW 3 144932373 missense probably benign 0.00
R2359:Clca4b UTSW 3 144925242 missense probably damaging 0.96
R3105:Clca4b UTSW 3 144916671 missense probably benign 0.02
R3151:Clca4b UTSW 3 144915511 missense probably benign 0.05
R3158:Clca4b UTSW 3 144912117 missense probably benign 0.04
R3177:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3277:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3981:Clca4b UTSW 3 144926036 missense probably benign 0.27
R4601:Clca4b UTSW 3 144927184 missense possibly damaging 0.81
R4646:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4647:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4696:Clca4b UTSW 3 144911385 missense probably benign 0.00
R4893:Clca4b UTSW 3 144925173 missense possibly damaging 0.67
R4998:Clca4b UTSW 3 144915508 missense probably benign 0.00
R5053:Clca4b UTSW 3 144911121 missense probably benign 0.01
R5060:Clca4b UTSW 3 144911506 missense probably damaging 1.00
R5319:Clca4b UTSW 3 144925179 missense possibly damaging 0.85
R5534:Clca4b UTSW 3 144915466 missense probably damaging 1.00
R5578:Clca4b UTSW 3 144932435 missense probably benign 0.04
R5667:Clca4b UTSW 3 144921863 missense probably benign
R5671:Clca4b UTSW 3 144921863 missense probably benign
R5715:Clca4b UTSW 3 144913257 missense probably benign 0.01
R5875:Clca4b UTSW 3 144922889 missense probably benign 0.38
R5876:Clca4b UTSW 3 144912060 missense possibly damaging 0.91
R6122:Clca4b UTSW 3 144926166 missense possibly damaging 0.67
R6294:Clca4b UTSW 3 144925185 missense probably null
R6408:Clca4b UTSW 3 144919275 missense probably benign 0.00
R6418:Clca4b UTSW 3 144928235 missense probably benign 0.02
R6458:Clca4b UTSW 3 144911327 missense possibly damaging 0.77
R6536:Clca4b UTSW 3 144916729 missense possibly damaging 0.66
R6567:Clca4b UTSW 3 144932339 missense possibly damaging 0.96
R6781:Clca4b UTSW 3 144922801 missense probably benign
R6799:Clca4b UTSW 3 144915627 splice site probably null
R7046:Clca4b UTSW 3 144915606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCAGGATCACACAGGTAAGG -3'
(R):5'- TGGCAAATCTATTCGGAGGG -3'

Sequencing Primer
(F):5'- TCACACAGGTAAGGAAAGTACATAC -3'
(R):5'- GAGAAAGCAAAGGTAAAACTGTTTTC -3'
Posted On2016-09-01