Incidental Mutation 'R5421:BC005561'
ID426556
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104518395 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 261 (N261I)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably benign
Transcript: ENSMUST00000096452
AA Change: N261I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: N261I

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGCTGATTGTTGAATTAGGGC -3'
(R):5'- CGGAAGGCAATACAACCATTG -3'

Sequencing Primer
(F):5'- GGGCAAGATTTATCTGGAAATATCAC -3'
(R):5'- GCTATCAGCTGGAAGAAG -3'
Posted On2016-09-01