Incidental Mutation 'R5422:BC005561'
ID426629
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
MMRRC Submission 042846-MU
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5422 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104519646 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 678 (I678T)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably damaging
Transcript: ENSMUST00000096452
AA Change: I678T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: I678T

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,698,974 S1219G probably benign Het
Adgrg5 T A 8: 94,933,952 I73N probably damaging Het
Agmat C A 4: 141,755,833 H193N probably damaging Het
Ambn T C 5: 88,464,511 probably null Het
Atp8b5 T A 4: 43,366,644 C803S probably benign Het
Btaf1 A T 19: 36,951,107 R109S probably benign Het
Btnl6 C T 17: 34,514,107 G261R possibly damaging Het
Cd163l1 A T 7: 140,224,155 H422L probably benign Het
Clk3 A G 9: 57,765,438 V27A probably benign Het
Clu A G 14: 65,975,602 S146G probably damaging Het
Cyp2w1 T C 5: 139,352,773 F43L probably benign Het
Elf3 C T 1: 135,255,040 E316K probably damaging Het
Epha5 A T 5: 84,331,490 D218E probably damaging Het
Ereg T C 5: 91,074,807 probably null Het
Ewsr1 A G 11: 5,080,668 probably benign Het
Fat4 A G 3: 38,887,245 I96V possibly damaging Het
Fgl2 T G 5: 21,375,810 N383K probably damaging Het
Fkbp11 A T 15: 98,728,108 probably null Het
Fn3k C A 11: 121,450,122 P201Q probably damaging Het
Fsip2 A G 2: 82,982,228 I2964V probably benign Het
Gbx1 C T 5: 24,504,669 V393I possibly damaging Het
Gch1 C T 14: 47,157,449 A187T probably damaging Het
Ghdc C A 11: 100,769,194 K242N probably benign Het
Ghrhr A G 6: 55,388,203 H394R probably benign Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,465,228 S236R probably benign Het
Kcnj5 A G 9: 32,317,705 Y66H probably benign Het
Kif15 T A 9: 122,984,889 probably null Het
Magi3 C T 3: 104,051,368 C467Y probably damaging Het
Map7 G T 10: 20,266,766 V303F probably damaging Het
Mapk11 A G 15: 89,146,285 L135P probably damaging Het
Mapkapk5 T A 5: 121,531,722 probably null Het
Myh7b A C 2: 155,631,034 Q1405P probably damaging Het
Nalcn A T 14: 123,515,365 I328N probably damaging Het
Nprl2 C A 9: 107,543,597 R144S probably benign Het
Ogfr G T 2: 180,595,274 D551Y possibly damaging Het
Ogfr A T 2: 180,595,275 D551V probably benign Het
Olfr250 A T 9: 38,367,974 T143S probably benign Het
Olfr524 A T 7: 140,202,392 V126E probably damaging Het
Parp14 T C 16: 35,866,175 K101E probably benign Het
Pcdhb16 A T 18: 37,479,867 T627S probably damaging Het
Pdzrn4 G A 15: 92,677,621 G303S probably benign Het
Plcl1 A T 1: 55,697,384 Y628F probably benign Het
Ptpn9 T A 9: 57,033,157 W194R probably damaging Het
Ranbp9 A T 13: 43,419,626 M474K probably benign Het
Rasgef1a T A 6: 118,088,134 F370Y probably damaging Het
Rassf5 C A 1: 131,181,174 R218L possibly damaging Het
Serpine2 C A 1: 79,816,875 V114L probably benign Het
Serpine2 T C 1: 79,821,489 Y16C probably benign Het
Sgms1 G T 19: 32,159,832 N111K probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tbc1d17 A T 7: 44,848,868 M1K probably null Het
Tcf12 A T 9: 71,869,038 H403Q probably damaging Het
Thsd7b T C 1: 129,921,334 S928P probably benign Het
Tjp1 A T 7: 65,302,967 F1540I probably damaging Het
Tph2 T A 10: 115,079,764 D457V possibly damaging Het
Usp9y T C Y: 1,314,676 I2112V probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp335 T C 2: 164,907,730 K249R probably damaging Het
Zfp54 C A 17: 21,434,526 S427R probably benign Het
Zfp607b A G 7: 27,702,388 T90A probably benign Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCACTGCGTTGAATTACGATG -3'
(R):5'- TCATGGTCCAGTAGTGCATCC -3'

Sequencing Primer
(F):5'- GCCTATTGTATCATTGAAGCACTAGC -3'
(R):5'- AGTGCATCCTTTAATCTCTGAGAGG -3'
Posted On2016-09-01