Incidental Mutation 'R5423:Adam22'
ID426697
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
MMRRC Submission 042989-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5423 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8090182 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 202 (G202W)
Ref Sequence ENSEMBL: ENSMUSP00000119409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046838] [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115386] [ENSMUST00000115388] [ENSMUST00000123168] [ENSMUST00000126384] [ENSMUST00000130315] [ENSMUST00000136524] [ENSMUST00000136808] [ENSMUST00000139048] [ENSMUST00000139841] [ENSMUST00000144241] [ENSMUST00000153427] [ENSMUST00000153889] [ENSMUST00000154935] [ENSMUST00000197700] [ENSMUST00000199853]
Predicted Effect probably benign
Transcript: ENSMUST00000046838
SMART Domains Protein: ENSMUSP00000049120
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 9.3e-9 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050166
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088744
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088761
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115386
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115388
AA Change: G839W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537
AA Change: G839W

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123168
SMART Domains Protein: ENSMUSP00000122758
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 123 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124121
SMART Domains Protein: ENSMUSP00000122652
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
Blast:ACR 2 52 5e-28 BLAST
EGF 59 93 1.28e1 SMART
transmembrane domain 118 140 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126384
SMART Domains Protein: ENSMUSP00000118571
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130315
AA Change: G137W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121156
Gene: ENSMUSG00000040537
AA Change: G137W

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 150 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136524
SMART Domains Protein: ENSMUSP00000116422
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 152 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136808
SMART Domains Protein: ENSMUSP00000122426
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139048
AA Change: G173W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116736
Gene: ENSMUSG00000040537
AA Change: G173W

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 186 206 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139841
AA Change: G131W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115775
Gene: ENSMUSG00000040537
AA Change: G131W

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 144 164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144241
SMART Domains Protein: ENSMUSP00000138353
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153427
AA Change: G167W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120995
Gene: ENSMUSG00000040537
AA Change: G167W

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
low complexity region 209 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153889
SMART Domains Protein: ENSMUSP00000123196
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154935
AA Change: G202W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119409
Gene: ENSMUSG00000040537
AA Change: G202W

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196356
Predicted Effect probably benign
Transcript: ENSMUST00000197700
SMART Domains Protein: ENSMUSP00000142580
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199853
SMART Domains Protein: ENSMUSP00000143097
Gene: ENSMUSG00000040537

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamts9 A G 6: 92,880,697 I289T possibly damaging Het
Ak4 T G 4: 101,460,563 I110S probably damaging Het
Arhgap9 T G 10: 127,329,549 I609S probably damaging Het
Arid4a C A 12: 71,069,860 S242* probably null Het
Ceacam1 T G 7: 25,474,526 I235L probably benign Het
Chil3 T C 3: 106,148,662 D365G probably damaging Het
Ckap2 A C 8: 22,177,196 S216R probably benign Het
Cyp2e1 G T 7: 140,770,118 V239L probably benign Het
Dnah7b T A 1: 46,358,271 M3954K probably benign Het
Ercc6l2 A T 13: 63,872,258 probably benign Het
Etv5 T C 16: 22,383,654 D468G probably damaging Het
Fbxo44 T A 4: 148,154,229 I213F probably benign Het
Gm5084 A G 13: 60,212,542 noncoding transcript Het
Gm5724 T A 6: 141,744,462 K188N probably damaging Het
Gpr17 G A 18: 31,947,641 T123I probably damaging Het
Grin3a A G 4: 49,770,376 probably benign Het
H2-D1 T G 17: 35,265,907 L248R probably damaging Het
Hmcn1 T C 1: 150,701,972 I2013V probably damaging Het
Hp1bp3 A T 4: 138,225,897 D84V probably damaging Het
Ift140 T C 17: 25,033,085 F33S probably damaging Het
Inhbc C G 10: 127,357,427 C240S probably damaging Het
Iqgap1 T A 7: 80,799,862 E62V probably damaging Het
Kcna4 G A 2: 107,295,806 W295* probably null Het
Kdm4a C T 4: 118,138,908 A975T probably damaging Het
Lrrtm3 T C 10: 64,088,152 D412G possibly damaging Het
Midn A C 10: 80,155,193 I346L probably benign Het
Ndufa10 C T 1: 92,462,320 D259N probably benign Het
Nefh C A 11: 4,940,985 A545S possibly damaging Het
Prpf8 A G 11: 75,508,958 Y2281C probably damaging Het
Psip1 G A 4: 83,460,130 probably benign Het
Ptpro G T 6: 137,442,707 A184S probably damaging Het
Rab37 T A 11: 115,157,027 I65K possibly damaging Het
Rasgrp4 T C 7: 29,145,136 L247P probably damaging Het
Rnf20 T C 4: 49,644,620 V295A probably damaging Het
Serpina3g A G 12: 104,237,994 probably benign Het
Shox2 A G 3: 66,973,754 probably benign Het
Skint6 T G 4: 112,850,740 D977A possibly damaging Het
Slc25a23 C T 17: 57,053,597 V248M probably damaging Het
Smg1 A T 7: 118,146,071 D3008E possibly damaging Het
St18 A G 1: 6,802,616 S192G possibly damaging Het
Supt20 T A 3: 54,709,325 V306E probably damaging Het
T T C 17: 8,441,765 Y403H probably damaging Het
Tarsl2 C A 7: 65,683,819 N588K probably benign Het
Tmem132c T C 5: 127,563,843 V1026A probably benign Het
Trpv4 T C 5: 114,636,445 T193A probably benign Het
Ubqln4 A G 3: 88,563,199 N326S probably damaging Het
Uggt2 G A 14: 119,019,486 T1112I probably damaging Het
Vasn C T 16: 4,648,420 P77L probably benign Het
Vps9d1 A C 8: 123,247,965 probably null Het
Washc4 C A 10: 83,579,554 Q803K possibly damaging Het
Zcchc2 C T 1: 106,030,700 T967I probably damaging Het
Zfp874a G A 13: 67,442,354 L404F possibly damaging Het
Zscan30 T C 18: 23,971,716 noncoding transcript Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1640:Adam22 UTSW 5 8145689 missense probably damaging 1.00
R1903:Adam22 UTSW 5 8134525 missense probably damaging 1.00
R1939:Adam22 UTSW 5 8330015 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2012:Adam22 UTSW 5 8117634 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4629:Adam22 UTSW 5 8232663 missense possibly damaging 0.95
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6520:Adam22 UTSW 5 8116635 missense probably damaging 0.98
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
R7317:Adam22 UTSW 5 8090202 missense probably benign
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCTAGGAGTACCACTGAACAG -3'
(R):5'- CATGCACCCCAAGTTCATGC -3'

Sequencing Primer
(F):5'- CCACTGAACAGATATGGGGGCTC -3'
(R):5'- CCAAGTTCATGCATGCTCTGTAAG -3'
Posted On2016-09-01