Incidental Mutation 'R5423:Inhbc'
ID426714
Institutional Source Beutler Lab
Gene Symbol Inhbc
Ensembl Gene ENSMUSG00000025405
Gene Nameinhibin beta-C
Synonymsactivin
MMRRC Submission 042989-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5423 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127356322-127370431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 127357427 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 240 (C240S)
Ref Sequence ENSEMBL: ENSMUSP00000026472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026472] [ENSMUST00000059718]
Predicted Effect probably damaging
Transcript: ENSMUST00000026472
AA Change: C240S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026472
Gene: ENSMUSG00000025405
AA Change: C240S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TGFB 247 352 7.32e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059718
SMART Domains Protein: ENSMUSP00000053977
Gene: ENSMUSG00000047492

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
TGFB 247 350 3.63e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of homodimeric and heterodimeric activin complexes. The heterodimeric complex may function in the inhibition of activin A signaling. Transgenic mice overexpressing this gene exhibit defects in testis, liver and prostate. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null mutation display decreased serum albumin in females but are fertile with normal liver and reproductive morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts9 A G 6: 92,880,697 I289T possibly damaging Het
Ak4 T G 4: 101,460,563 I110S probably damaging Het
Arhgap9 T G 10: 127,329,549 I609S probably damaging Het
Arid4a C A 12: 71,069,860 S242* probably null Het
Ceacam1 T G 7: 25,474,526 I235L probably benign Het
Chil3 T C 3: 106,148,662 D365G probably damaging Het
Ckap2 A C 8: 22,177,196 S216R probably benign Het
Cyp2e1 G T 7: 140,770,118 V239L probably benign Het
Dnah7b T A 1: 46,358,271 M3954K probably benign Het
Ercc6l2 A T 13: 63,872,258 probably benign Het
Etv5 T C 16: 22,383,654 D468G probably damaging Het
Fbxo44 T A 4: 148,154,229 I213F probably benign Het
Gm5084 A G 13: 60,212,542 noncoding transcript Het
Gm5724 T A 6: 141,744,462 K188N probably damaging Het
Gpr17 G A 18: 31,947,641 T123I probably damaging Het
Grin3a A G 4: 49,770,376 probably benign Het
H2-D1 T G 17: 35,265,907 L248R probably damaging Het
Hmcn1 T C 1: 150,701,972 I2013V probably damaging Het
Hp1bp3 A T 4: 138,225,897 D84V probably damaging Het
Ift140 T C 17: 25,033,085 F33S probably damaging Het
Iqgap1 T A 7: 80,799,862 E62V probably damaging Het
Kcna4 G A 2: 107,295,806 W295* probably null Het
Kdm4a C T 4: 118,138,908 A975T probably damaging Het
Lrrtm3 T C 10: 64,088,152 D412G possibly damaging Het
Midn A C 10: 80,155,193 I346L probably benign Het
Ndufa10 C T 1: 92,462,320 D259N probably benign Het
Nefh C A 11: 4,940,985 A545S possibly damaging Het
Prpf8 A G 11: 75,508,958 Y2281C probably damaging Het
Psip1 G A 4: 83,460,130 probably benign Het
Ptpro G T 6: 137,442,707 A184S probably damaging Het
Rab37 T A 11: 115,157,027 I65K possibly damaging Het
Rasgrp4 T C 7: 29,145,136 L247P probably damaging Het
Rnf20 T C 4: 49,644,620 V295A probably damaging Het
Serpina3g A G 12: 104,237,994 probably benign Het
Shox2 A G 3: 66,973,754 probably benign Het
Skint6 T G 4: 112,850,740 D977A possibly damaging Het
Slc25a23 C T 17: 57,053,597 V248M probably damaging Het
Smg1 A T 7: 118,146,071 D3008E possibly damaging Het
St18 A G 1: 6,802,616 S192G possibly damaging Het
Supt20 T A 3: 54,709,325 V306E probably damaging Het
T T C 17: 8,441,765 Y403H probably damaging Het
Tarsl2 C A 7: 65,683,819 N588K probably benign Het
Tmem132c T C 5: 127,563,843 V1026A probably benign Het
Trpv4 T C 5: 114,636,445 T193A probably benign Het
Ubqln4 A G 3: 88,563,199 N326S probably damaging Het
Uggt2 G A 14: 119,019,486 T1112I probably damaging Het
Vasn C T 16: 4,648,420 P77L probably benign Het
Vps9d1 A C 8: 123,247,965 probably null Het
Washc4 C A 10: 83,579,554 Q803K possibly damaging Het
Zcchc2 C T 1: 106,030,700 T967I probably damaging Het
Zfp874a G A 13: 67,442,354 L404F possibly damaging Het
Zscan30 T C 18: 23,971,716 noncoding transcript Het
Other mutations in Inhbc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Inhbc APN 10 127370099 missense probably damaging 1.00
IGL02114:Inhbc APN 10 127370102 missense probably benign 0.00
LCD18:Inhbc UTSW 10 127367140 intron probably benign
R0042:Inhbc UTSW 10 127357433 missense probably benign 0.17
R0760:Inhbc UTSW 10 127357368 missense probably damaging 1.00
R1339:Inhbc UTSW 10 127357641 missense probably benign
R1754:Inhbc UTSW 10 127370293 missense possibly damaging 0.84
R1867:Inhbc UTSW 10 127357547 missense probably benign 0.01
R2902:Inhbc UTSW 10 127357752 missense probably benign
R4622:Inhbc UTSW 10 127357277 missense probably benign 0.26
R5128:Inhbc UTSW 10 127357742 missense probably benign 0.12
R5285:Inhbc UTSW 10 127357400 missense probably damaging 1.00
R5807:Inhbc UTSW 10 127357542 nonsense probably null
R5815:Inhbc UTSW 10 127357449 missense probably benign 0.01
R6483:Inhbc UTSW 10 127357440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGAGCAGATTCAGCAC -3'
(R):5'- AAGTCAGTACGTGGTGCAGG -3'

Sequencing Primer
(F):5'- CACTGCAGTGTGAAAGGAGGC -3'
(R):5'- AGCTTCTCCTGGGACCTGAAG -3'
Posted On2016-09-01