Incidental Mutation 'R5423:Uggt2'
List |< first << previous [record 49 of 55] next >> last >|
ID426725
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene NameUDP-glucose glycoprotein glucosyltransferase 2
Synonyms3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik
MMRRC Submission 042989-MU
Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5423 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location118985039-119099430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119019486 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1112 (T1112I)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]
Predicted Effect probably benign
Transcript: ENSMUST00000127153
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
low complexity region 327 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153693
SMART Domains Protein: ENSMUSP00000123327
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 1 106 3.3e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156203
AA Change: T1112I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: T1112I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173391
SMART Domains Protein: ENSMUSP00000133772
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 2 63 9.4e-18 PFAM
SCOP:d1ga8a_ 77 216 3e-21 SMART
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts9 A G 6: 92,880,697 I289T possibly damaging Het
Ak4 T G 4: 101,460,563 I110S probably damaging Het
Arhgap9 T G 10: 127,329,549 I609S probably damaging Het
Arid4a C A 12: 71,069,860 S242* probably null Het
Ceacam1 T G 7: 25,474,526 I235L probably benign Het
Chil3 T C 3: 106,148,662 D365G probably damaging Het
Ckap2 A C 8: 22,177,196 S216R probably benign Het
Cyp2e1 G T 7: 140,770,118 V239L probably benign Het
Dnah7b T A 1: 46,358,271 M3954K probably benign Het
Ercc6l2 A T 13: 63,872,258 probably benign Het
Etv5 T C 16: 22,383,654 D468G probably damaging Het
Fbxo44 T A 4: 148,154,229 I213F probably benign Het
Gm5084 A G 13: 60,212,542 noncoding transcript Het
Gm5724 T A 6: 141,744,462 K188N probably damaging Het
Gpr17 G A 18: 31,947,641 T123I probably damaging Het
Grin3a A G 4: 49,770,376 probably benign Het
H2-D1 T G 17: 35,265,907 L248R probably damaging Het
Hmcn1 T C 1: 150,701,972 I2013V probably damaging Het
Hp1bp3 A T 4: 138,225,897 D84V probably damaging Het
Ift140 T C 17: 25,033,085 F33S probably damaging Het
Inhbc C G 10: 127,357,427 C240S probably damaging Het
Iqgap1 T A 7: 80,799,862 E62V probably damaging Het
Kcna4 G A 2: 107,295,806 W295* probably null Het
Kdm4a C T 4: 118,138,908 A975T probably damaging Het
Lrrtm3 T C 10: 64,088,152 D412G possibly damaging Het
Midn A C 10: 80,155,193 I346L probably benign Het
Ndufa10 C T 1: 92,462,320 D259N probably benign Het
Nefh C A 11: 4,940,985 A545S possibly damaging Het
Prpf8 A G 11: 75,508,958 Y2281C probably damaging Het
Psip1 G A 4: 83,460,130 probably benign Het
Ptpro G T 6: 137,442,707 A184S probably damaging Het
Rab37 T A 11: 115,157,027 I65K possibly damaging Het
Rasgrp4 T C 7: 29,145,136 L247P probably damaging Het
Rnf20 T C 4: 49,644,620 V295A probably damaging Het
Serpina3g A G 12: 104,237,994 probably benign Het
Shox2 A G 3: 66,973,754 probably benign Het
Skint6 T G 4: 112,850,740 D977A possibly damaging Het
Slc25a23 C T 17: 57,053,597 V248M probably damaging Het
Smg1 A T 7: 118,146,071 D3008E possibly damaging Het
St18 A G 1: 6,802,616 S192G possibly damaging Het
Supt20 T A 3: 54,709,325 V306E probably damaging Het
T T C 17: 8,441,765 Y403H probably damaging Het
Tarsl2 C A 7: 65,683,819 N588K probably benign Het
Tmem132c T C 5: 127,563,843 V1026A probably benign Het
Trpv4 T C 5: 114,636,445 T193A probably benign Het
Ubqln4 A G 3: 88,563,199 N326S probably damaging Het
Vasn C T 16: 4,648,420 P77L probably benign Het
Vps9d1 A C 8: 123,247,965 probably null Het
Washc4 C A 10: 83,579,554 Q803K possibly damaging Het
Zcchc2 C T 1: 106,030,700 T967I probably damaging Het
Zfp874a G A 13: 67,442,354 L404F possibly damaging Het
Zscan30 T C 18: 23,971,716 noncoding transcript Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119049276 missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119026429 nonsense probably null
IGL00433:Uggt2 APN 14 119013487 missense probably benign
IGL00572:Uggt2 APN 14 119042791 missense probably benign 0.02
IGL00577:Uggt2 APN 14 119034900 missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119042799 missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119057645 missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119042772 missense probably benign 0.00
IGL01787:Uggt2 APN 14 119081734 missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119089193 missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119090738 missense probably benign 0.17
IGL02894:Uggt2 APN 14 119081799 missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119075346 missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119095310 missense probably benign 0.25
IGL03142:Uggt2 APN 14 118998191 missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119077668 missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119070888 missense probably benign 0.38
P0014:Uggt2 UTSW 14 119044538 missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119049663 missense probably benign 0.07
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0383:Uggt2 UTSW 14 119049451 missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119075329 critical splice donor site probably null
R0472:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119057598 missense probably benign 0.27
R0788:Uggt2 UTSW 14 119095400 splice site probably benign
R0940:Uggt2 UTSW 14 119091192 critical splice donor site probably null
R1567:Uggt2 UTSW 14 119009093 missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119057663 missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119054643 missense probably benign 0.19
R1746:Uggt2 UTSW 14 119013503 missense probably benign 0.00
R1785:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119032276 missense probably benign 0.00
R1894:Uggt2 UTSW 14 119049718 missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119008055 splice site probably benign
R2149:Uggt2 UTSW 14 119075345 missense probably benign 0.02
R2168:Uggt2 UTSW 14 119019505 missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2240:Uggt2 UTSW 14 118995049 missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119026599 missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119059109 missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2907:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2908:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2998:Uggt2 UTSW 14 119049385 missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119091270 missense probably benign 0.39
R3722:Uggt2 UTSW 14 119041518 missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119057672 missense probably benign 0.13
R4015:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119049262 missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119019558 missense probably benign
R4642:Uggt2 UTSW 14 119034935 missense probably benign 0.00
R4654:Uggt2 UTSW 14 119032258 missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119029054 splice site probably null
R4810:Uggt2 UTSW 14 119013521 missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119001847 missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119035964 splice site probably null
R4886:Uggt2 UTSW 14 119035964 splice site probably null
R4888:Uggt2 UTSW 14 119049253 missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119077650 critical splice donor site probably null
R4895:Uggt2 UTSW 14 119018886 missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119081770 missense probably benign 0.00
R5476:Uggt2 UTSW 14 119090709 missense probably benign 0.01
R5561:Uggt2 UTSW 14 119041527 missense probably benign 0.02
R5607:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119077724 missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119042726 missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119049426 missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6056:Uggt2 UTSW 14 119035969 critical splice donor site probably null
R6289:Uggt2 UTSW 14 119041602 missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119057564 missense probably benign 0.01
R6515:Uggt2 UTSW 14 119077719 missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119070881 missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119042610 missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119026435 missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119001859 missense probably benign 0.10
R7117:Uggt2 UTSW 14 119014526 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGATAGGACTTCATCATTCCTGAC -3'
(R):5'- AAATTGGTGGTTGGATCAGTTCAC -3'

Sequencing Primer
(F):5'- GACTGTAATCTGAGTCCCAGCAG -3'
(R):5'- TGTATAGGATTCATAATACCCAACCC -3'
Posted On2016-09-01