Incidental Mutation 'R5423:Gpr17'
List |< first << previous [record 17 of 55] next >> last >|
ID426732
Institutional Source Beutler Lab
Gene Symbol Gpr17
Ensembl Gene ENSMUSG00000052229
Gene NameG protein-coupled receptor 17
Synonyms
MMRRC Submission 042989-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5423 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location31942997-31949636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31947641 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 123 (T123I)
Ref Sequence ENSEMBL: ENSMUSP00000063670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025254] [ENSMUST00000064016] [ENSMUST00000224383] [ENSMUST00000225404]
Predicted Effect probably benign
Transcript: ENSMUST00000025254
SMART Domains Protein: ENSMUSP00000025254
Gene: ENSMUSG00000024395

DomainStartEndE-ValueType
LIM 14 67 1.15e-14 SMART
LIM 75 126 2.74e-12 SMART
LIM 139 189 3.87e-12 SMART
LIM 197 248 4.31e-19 SMART
LIM 256 308 2.67e-15 SMART
low complexity region 314 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064016
AA Change: T123I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063670
Gene: ENSMUSG00000052229
AA Change: T123I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 289 4.7e-7 PFAM
Pfam:7tm_1 48 297 1.1e-45 PFAM
Pfam:7TM_GPCR_Srv 70 268 2.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224383
Predicted Effect probably benign
Transcript: ENSMUST00000225404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225470
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit early differentiation of oligodendroglial progenitor cells and increased myelination without any behavioral or motor deficits. Homozygotes for a different null allele show increased vascular permeability in IgE-dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts9 A G 6: 92,880,697 I289T possibly damaging Het
Ak4 T G 4: 101,460,563 I110S probably damaging Het
Arhgap9 T G 10: 127,329,549 I609S probably damaging Het
Arid4a C A 12: 71,069,860 S242* probably null Het
Ceacam1 T G 7: 25,474,526 I235L probably benign Het
Chil3 T C 3: 106,148,662 D365G probably damaging Het
Ckap2 A C 8: 22,177,196 S216R probably benign Het
Cyp2e1 G T 7: 140,770,118 V239L probably benign Het
Dnah7b T A 1: 46,358,271 M3954K probably benign Het
Ercc6l2 A T 13: 63,872,258 probably benign Het
Etv5 T C 16: 22,383,654 D468G probably damaging Het
Fbxo44 T A 4: 148,154,229 I213F probably benign Het
Gm5084 A G 13: 60,212,542 noncoding transcript Het
Gm5724 T A 6: 141,744,462 K188N probably damaging Het
Grin3a A G 4: 49,770,376 probably benign Het
H2-D1 T G 17: 35,265,907 L248R probably damaging Het
Hmcn1 T C 1: 150,701,972 I2013V probably damaging Het
Hp1bp3 A T 4: 138,225,897 D84V probably damaging Het
Ift140 T C 17: 25,033,085 F33S probably damaging Het
Inhbc C G 10: 127,357,427 C240S probably damaging Het
Iqgap1 T A 7: 80,799,862 E62V probably damaging Het
Kcna4 G A 2: 107,295,806 W295* probably null Het
Kdm4a C T 4: 118,138,908 A975T probably damaging Het
Lrrtm3 T C 10: 64,088,152 D412G possibly damaging Het
Midn A C 10: 80,155,193 I346L probably benign Het
Ndufa10 C T 1: 92,462,320 D259N probably benign Het
Nefh C A 11: 4,940,985 A545S possibly damaging Het
Prpf8 A G 11: 75,508,958 Y2281C probably damaging Het
Psip1 G A 4: 83,460,130 probably benign Het
Ptpro G T 6: 137,442,707 A184S probably damaging Het
Rab37 T A 11: 115,157,027 I65K possibly damaging Het
Rasgrp4 T C 7: 29,145,136 L247P probably damaging Het
Rnf20 T C 4: 49,644,620 V295A probably damaging Het
Serpina3g A G 12: 104,237,994 probably benign Het
Shox2 A G 3: 66,973,754 probably benign Het
Skint6 T G 4: 112,850,740 D977A possibly damaging Het
Slc25a23 C T 17: 57,053,597 V248M probably damaging Het
Smg1 A T 7: 118,146,071 D3008E possibly damaging Het
St18 A G 1: 6,802,616 S192G possibly damaging Het
Supt20 T A 3: 54,709,325 V306E probably damaging Het
T T C 17: 8,441,765 Y403H probably damaging Het
Tarsl2 C A 7: 65,683,819 N588K probably benign Het
Tmem132c T C 5: 127,563,843 V1026A probably benign Het
Trpv4 T C 5: 114,636,445 T193A probably benign Het
Ubqln4 A G 3: 88,563,199 N326S probably damaging Het
Uggt2 G A 14: 119,019,486 T1112I probably damaging Het
Vasn C T 16: 4,648,420 P77L probably benign Het
Vps9d1 A C 8: 123,247,965 probably null Het
Washc4 C A 10: 83,579,554 Q803K possibly damaging Het
Zcchc2 C T 1: 106,030,700 T967I probably damaging Het
Zfp874a G A 13: 67,442,354 L404F possibly damaging Het
Zscan30 T C 18: 23,971,716 noncoding transcript Het
Other mutations in Gpr17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Gpr17 APN 18 31947134 missense probably damaging 1.00
R4492:Gpr17 UTSW 18 31947251 missense possibly damaging 0.86
R6008:Gpr17 UTSW 18 31947477 missense probably benign 0.00
R6363:Gpr17 UTSW 18 31947572 missense probably damaging 0.98
R6627:Gpr17 UTSW 18 31947896 missense probably damaging 1.00
X0025:Gpr17 UTSW 18 31947115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTCTCCCGGTACAGTTGCAG -3'
(R):5'- TGGCTTTTCATATGGGACCAC -3'

Sequencing Primer
(F):5'- TTGCAGGCAGACAACTGTGTG -3'
(R):5'- GGCTTTTCATATGGGACCACAAGTC -3'
Posted On2016-09-01