Incidental Mutation 'R5424:Nes'
ID426744
Institutional Source Beutler Lab
Gene Symbol Nes
Ensembl Gene ENSMUSG00000004891
Gene Namenestin
SynonymsESTM46
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87971078-87980451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87978824 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1419 (E1419D)
Ref Sequence ENSEMBL: ENSMUSP00000125571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090973] [ENSMUST00000160694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090973
AA Change: E1463D

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088493
Gene: ENSMUSG00000004891
AA Change: E1463D

DomainStartEndE-ValueType
Filament 7 313 1.81e-37 SMART
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 470 771 2.37e-7 PROSPERO
internal_repeat_1 614 832 5.41e-11 PROSPERO
internal_repeat_2 851 1174 2.37e-7 PROSPERO
internal_repeat_1 1064 1304 5.41e-11 PROSPERO
low complexity region 1347 1366 N/A INTRINSIC
low complexity region 1426 1438 N/A INTRINSIC
low complexity region 1653 1683 N/A INTRINSIC
low complexity region 1713 1724 N/A INTRINSIC
low complexity region 1741 1760 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160694
AA Change: E1419D

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125571
Gene: ENSMUSG00000004891
AA Change: E1419D

DomainStartEndE-ValueType
Pfam:Filament 7 313 3.5e-29 PFAM
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 456 672 1.06e-5 PROSPERO
internal_repeat_1 470 798 1.21e-11 PROSPERO
internal_repeat_1 807 1134 1.21e-11 PROSPERO
internal_repeat_2 1024 1213 1.06e-5 PROSPERO
low complexity region 1303 1322 N/A INTRINSIC
low complexity region 1382 1394 N/A INTRINSIC
low complexity region 1609 1639 N/A INTRINSIC
low complexity region 1669 1680 N/A INTRINSIC
low complexity region 1697 1716 N/A INTRINSIC
Meta Mutation Damage Score 0.006 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a high incidence of embryonic lethality, reduced embryo and birth body size, and fewer neural stem cells and increased apoptosis in the neuroepithelium of the developing neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Actb A G 5: 142,905,551 probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Aire A T 10: 78,036,719 V355E probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gas8 C A 8: 123,526,512 L200I possibly damaging Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ifit2 T A 19: 34,574,058 C333S probably benign Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nipa1 C A 7: 55,979,475 V297L possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tgm7 T A 2: 121,099,041 M251L probably damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Nes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Nes APN 3 87976254 nonsense probably null
IGL01532:Nes APN 3 87978347 missense possibly damaging 0.54
IGL01544:Nes APN 3 87977964 missense possibly damaging 0.93
IGL02609:Nes APN 3 87977221 missense probably benign 0.33
IGL02877:Nes APN 3 87975661 missense probably benign 0.04
IGL02937:Nes APN 3 87979879 missense probably benign
R0271:Nes UTSW 3 87978642 missense possibly damaging 0.91
R0587:Nes UTSW 3 87978569 missense probably benign 0.08
R0625:Nes UTSW 3 87977172 missense possibly damaging 0.91
R0741:Nes UTSW 3 87978967 missense probably damaging 0.98
R1256:Nes UTSW 3 87976576 missense probably benign
R1630:Nes UTSW 3 87977677 missense probably benign 0.32
R1702:Nes UTSW 3 87975979 missense probably benign 0.04
R1724:Nes UTSW 3 87977441 missense probably benign
R1738:Nes UTSW 3 87976421 nonsense probably null
R1853:Nes UTSW 3 87975807 missense possibly damaging 0.91
R1946:Nes UTSW 3 87978514 missense possibly damaging 0.79
R1971:Nes UTSW 3 87978327 missense possibly damaging 0.81
R2013:Nes UTSW 3 87976678 missense possibly damaging 0.51
R2111:Nes UTSW 3 87977311 missense probably benign 0.04
R2232:Nes UTSW 3 87978931 missense possibly damaging 0.93
R2392:Nes UTSW 3 87975943 missense probably benign 0.08
R3548:Nes UTSW 3 87973122 splice site probably benign
R3937:Nes UTSW 3 87971236 missense probably benign 0.02
R4239:Nes UTSW 3 87979359 missense probably damaging 1.00
R4240:Nes UTSW 3 87979359 missense probably damaging 1.00
R4426:Nes UTSW 3 87976042 missense probably damaging 0.96
R4493:Nes UTSW 3 87976813 missense probably damaging 0.96
R4494:Nes UTSW 3 87976813 missense probably damaging 0.96
R4674:Nes UTSW 3 87971795 missense possibly damaging 0.51
R4772:Nes UTSW 3 87976179 missense probably benign 0.02
R4959:Nes UTSW 3 87975676 missense probably damaging 0.99
R4973:Nes UTSW 3 87975676 missense probably damaging 0.99
R5055:Nes UTSW 3 87977214 missense probably benign
R5207:Nes UTSW 3 87978628 missense probably damaging 1.00
R5289:Nes UTSW 3 87978418 missense probably damaging 0.98
R5420:Nes UTSW 3 87977002 missense probably damaging 0.99
R5697:Nes UTSW 3 87977848 missense probably damaging 0.96
R5940:Nes UTSW 3 87975952 missense probably damaging 0.99
R6661:Nes UTSW 3 87976936 missense probably damaging 0.96
R6905:Nes UTSW 3 87978678 missense probably damaging 0.99
R7087:Nes UTSW 3 87979758 missense probably benign 0.00
X0019:Nes UTSW 3 87977418 missense probably benign 0.15
X0062:Nes UTSW 3 87977726 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAAAGAGGCAGGTGCTC -3'
(R):5'- ACTTCAGGTAGAGGCCCAAG -3'

Sequencing Primer
(F):5'- TGCTCTGGACTCAGGCATC -3'
(R):5'- TGGAGGCCCTCAGGAATCTC -3'
Posted On2016-09-01