Incidental Mutation 'R5426:Dnah7b'
ID426852
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Namedynein, axonemal, heavy chain 7B
SynonymsDnahc7b, LOC227058
MMRRC Submission 042992-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R5426 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location46066315-46373546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46242206 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 2809 (M2809T)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069293
AA Change: M2809T

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: M2809T

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187548
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,003 H122L probably damaging Het
9330182O14Rik G A 15: 40,148,536 M90I unknown Het
9330182O14Rik G A 15: 40,148,537 D91N unknown Het
Abca13 T A 11: 9,290,722 S862T probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgb C A 10: 10,350,260 A1405S probably benign Het
Adpgk T A 9: 59,297,549 V86E probably damaging Het
Agfg2 G C 5: 137,667,758 P80A probably damaging Het
Akap11 G A 14: 78,498,864 Q1829* probably null Het
Aldh1l1 G A 6: 90,559,299 R62Q probably benign Het
Als2cr12 T A 1: 58,666,886 K275* probably null Het
Amd1 G T 10: 40,290,187 D265E probably damaging Het
Aox4 A T 1: 58,220,094 Q106L probably damaging Het
Arap2 A T 5: 62,642,816 N1289K probably benign Het
Arhgef12 T C 9: 42,986,584 S874G probably damaging Het
BC067074 G A 13: 113,369,053 V2239I probably benign Het
C87499 T A 4: 88,629,410 probably benign Het
Ccdc166 T C 15: 75,982,096 Q45R possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk14 A G 5: 4,888,975 S388P possibly damaging Het
Chgb A T 2: 132,793,533 Q465L possibly damaging Het
Commd9 T A 2: 101,898,875 W109R probably damaging Het
Cyp2b9 T C 7: 26,187,655 V163A probably benign Het
Dcpp2 T A 17: 23,899,313 H27Q possibly damaging Het
Ddn T A 15: 98,806,466 E315V possibly damaging Het
Defb29 C A 2: 152,538,948 C47F probably damaging Het
Dock4 A T 12: 40,745,745 I854F probably damaging Het
Dsg4 T C 18: 20,458,484 Y427H probably damaging Het
E130114P18Rik C T 4: 97,690,670 A23T unknown Het
Gemin5 A G 11: 58,125,287 S1297P probably benign Het
Gm10309 A C 17: 86,498,733 probably benign Het
Gm884 A T 11: 103,620,760 H127Q unknown Het
Gpatch11 T A 17: 78,841,234 S155R possibly damaging Het
Grin2b C A 6: 135,732,368 Q1393H probably damaging Het
Heatr5b C T 17: 78,773,713 C1370Y probably damaging Het
Hmcn2 C T 2: 31,336,544 T177I possibly damaging Het
Ildr1 A T 16: 36,709,619 I123F probably damaging Het
Kalrn A T 16: 34,262,653 V644D probably damaging Het
Kifap3 A G 1: 163,779,871 M1V probably null Het
Klhl11 A G 11: 100,464,116 L293P probably damaging Het
Klrc3 G A 6: 129,641,550 S98L probably benign Het
Med12l G A 3: 59,248,722 M1220I probably damaging Het
Ms4a7 C T 19: 11,325,802 probably null Het
Mybpc2 A G 7: 44,509,829 V599A probably benign Het
Naalad2 T C 9: 18,347,519 N487D probably benign Het
Nat8f7 T G 6: 85,707,823 S12R probably benign Het
Nefm T A 14: 68,120,066 probably benign Het
Nlrp5 T C 7: 23,418,201 V450A probably damaging Het
Nps G A 7: 135,268,647 probably null Het
Olfr1247 T C 2: 89,609,739 Y121C probably damaging Het
Olfr142 T A 2: 90,252,611 K126* probably null Het
Olfr159 A G 4: 43,770,168 I281T probably benign Het
Olfr192 G T 16: 59,098,302 P230Q possibly damaging Het
Olfr492 T C 7: 108,322,810 N289D probably damaging Het
Olfr513 T C 7: 108,755,717 L287P possibly damaging Het
Olfr698 C A 7: 106,752,566 S274I probably benign Het
Oxct2a C A 4: 123,322,713 G292W possibly damaging Het
Prr27 T C 5: 87,850,885 probably benign Het
Ptx3 T C 3: 66,220,722 M68T probably damaging Het
Rufy1 A G 11: 50,421,734 L131S probably damaging Het
Sept7 T A 9: 25,286,690 I100N possibly damaging Het
Sgms2 T C 3: 131,341,797 I143V probably benign Het
Slc25a34 A G 4: 141,623,566 V44A probably damaging Het
Slc28a3 T A 13: 58,563,154 D518V probably damaging Het
Slc6a7 C T 18: 61,003,236 probably null Het
Slco4a1 C A 2: 180,471,235 A420D possibly damaging Het
Smap1 T C 1: 23,849,390 T180A probably benign Het
Specc1l T C 10: 75,267,550 S920P probably benign Het
Tgtp2 A G 11: 49,059,256 M163T probably benign Het
Tiam1 G T 16: 89,865,392 Q613K possibly damaging Het
Vsig10l T A 7: 43,464,823 S190T probably damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wdfy3 T A 5: 101,919,446 N1207Y probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr70 A G 15: 7,922,105 L417S possibly damaging Het
Wdr81 A C 11: 75,450,896 S1182A possibly damaging Het
Zfp458 A T 13: 67,257,192 C391* probably null Het
Zfp638 A G 6: 83,976,414 E1167G probably damaging Het
Zfp763 T A 17: 33,019,595 D192V probably benign Het
Zfp853 T G 5: 143,288,869 Q332P unknown Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 intron probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site unknown
R7135:Dnah7b UTSW 1 46139710 missense not run
R7153:Dnah7b UTSW 1 46126804 missense not run
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTTGTCATGGAAGCTATCTGC -3'
(R):5'- AAACGCGTGTTTTCTGACCAC -3'

Sequencing Primer
(F):5'- CTGCATATTGAAAGGTATCAAAGCCG -3'
(R):5'- TCTCACATGGGCTCCTAGC -3'
Posted On2016-09-01