Incidental Mutation 'R5426:C87499'
ID426867
Institutional Source Beutler Lab
Gene Symbol C87499
Ensembl Gene ENSMUSG00000038330
Gene Nameexpressed sequence C87499
Synonyms
MMRRC Submission 042992-MU
Accession Numbers

Ncbi RefSeq:NM_198663.3; MGI:2140706

Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R5426 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88627320-88634411 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 88629410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053304] [ENSMUST00000107142] [ENSMUST00000107143] [ENSMUST00000134155] [ENSMUST00000156062]
Predicted Effect probably benign
Transcript: ENSMUST00000053304
SMART Domains Protein: ENSMUSP00000056691
Gene: ENSMUSG00000038330

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 425 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107142
Predicted Effect probably benign
Transcript: ENSMUST00000107143
Predicted Effect probably benign
Transcript: ENSMUST00000134155
Predicted Effect unknown
Transcript: ENSMUST00000156062
AA Change: D8V
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (85/88)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,003 H122L probably damaging Het
9330182O14Rik G A 15: 40,148,536 M90I unknown Het
9330182O14Rik G A 15: 40,148,537 D91N unknown Het
Abca13 T A 11: 9,290,722 S862T probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgb C A 10: 10,350,260 A1405S probably benign Het
Adpgk T A 9: 59,297,549 V86E probably damaging Het
Agfg2 G C 5: 137,667,758 P80A probably damaging Het
Akap11 G A 14: 78,498,864 Q1829* probably null Het
Aldh1l1 G A 6: 90,559,299 R62Q probably benign Het
Als2cr12 T A 1: 58,666,886 K275* probably null Het
Amd1 G T 10: 40,290,187 D265E probably damaging Het
Aox4 A T 1: 58,220,094 Q106L probably damaging Het
Arap2 A T 5: 62,642,816 N1289K probably benign Het
Arhgef12 T C 9: 42,986,584 S874G probably damaging Het
BC067074 G A 13: 113,369,053 V2239I probably benign Het
Ccdc166 T C 15: 75,982,096 Q45R possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk14 A G 5: 4,888,975 S388P possibly damaging Het
Chgb A T 2: 132,793,533 Q465L possibly damaging Het
Commd9 T A 2: 101,898,875 W109R probably damaging Het
Cyp2b9 T C 7: 26,187,655 V163A probably benign Het
Dcpp2 T A 17: 23,899,313 H27Q possibly damaging Het
Ddn T A 15: 98,806,466 E315V possibly damaging Het
Defb29 C A 2: 152,538,948 C47F probably damaging Het
Dnah7b T C 1: 46,242,206 M2809T possibly damaging Het
Dock4 A T 12: 40,745,745 I854F probably damaging Het
Dsg4 T C 18: 20,458,484 Y427H probably damaging Het
E130114P18Rik C T 4: 97,690,670 A23T unknown Het
Gemin5 A G 11: 58,125,287 S1297P probably benign Het
Gm10309 A C 17: 86,498,733 probably benign Het
Gm884 A T 11: 103,620,760 H127Q unknown Het
Gpatch11 T A 17: 78,841,234 S155R possibly damaging Het
Grin2b C A 6: 135,732,368 Q1393H probably damaging Het
Heatr5b C T 17: 78,773,713 C1370Y probably damaging Het
Hmcn2 C T 2: 31,336,544 T177I possibly damaging Het
Ildr1 A T 16: 36,709,619 I123F probably damaging Het
Kalrn A T 16: 34,262,653 V644D probably damaging Het
Kifap3 A G 1: 163,779,871 M1V probably null Het
Klhl11 A G 11: 100,464,116 L293P probably damaging Het
Klrc3 G A 6: 129,641,550 S98L probably benign Het
Med12l G A 3: 59,248,722 M1220I probably damaging Het
Ms4a7 C T 19: 11,325,802 probably null Het
Mybpc2 A G 7: 44,509,829 V599A probably benign Het
Naalad2 T C 9: 18,347,519 N487D probably benign Het
Nat8f7 T G 6: 85,707,823 S12R probably benign Het
Nefm T A 14: 68,120,066 probably benign Het
Nlrp5 T C 7: 23,418,201 V450A probably damaging Het
Nps G A 7: 135,268,647 probably null Het
Olfr1247 T C 2: 89,609,739 Y121C probably damaging Het
Olfr142 T A 2: 90,252,611 K126* probably null Het
Olfr159 A G 4: 43,770,168 I281T probably benign Het
Olfr192 G T 16: 59,098,302 P230Q possibly damaging Het
Olfr492 T C 7: 108,322,810 N289D probably damaging Het
Olfr513 T C 7: 108,755,717 L287P possibly damaging Het
Olfr698 C A 7: 106,752,566 S274I probably benign Het
Oxct2a C A 4: 123,322,713 G292W possibly damaging Het
Prr27 T C 5: 87,850,885 probably benign Het
Ptx3 T C 3: 66,220,722 M68T probably damaging Het
Rufy1 A G 11: 50,421,734 L131S probably damaging Het
Sept7 T A 9: 25,286,690 I100N possibly damaging Het
Sgms2 T C 3: 131,341,797 I143V probably benign Het
Slc25a34 A G 4: 141,623,566 V44A probably damaging Het
Slc28a3 T A 13: 58,563,154 D518V probably damaging Het
Slc6a7 C T 18: 61,003,236 probably null Het
Slco4a1 C A 2: 180,471,235 A420D possibly damaging Het
Smap1 T C 1: 23,849,390 T180A probably benign Het
Specc1l T C 10: 75,267,550 S920P probably benign Het
Tgtp2 A G 11: 49,059,256 M163T probably benign Het
Tiam1 G T 16: 89,865,392 Q613K possibly damaging Het
Vsig10l T A 7: 43,464,823 S190T probably damaging Het
Vwa3b A G 1: 37,115,671 Y512C probably damaging Het
Wdfy3 T A 5: 101,919,446 N1207Y probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr70 A G 15: 7,922,105 L417S possibly damaging Het
Wdr81 A C 11: 75,450,896 S1182A possibly damaging Het
Zfp458 A T 13: 67,257,192 C391* probably null Het
Zfp638 A G 6: 83,976,414 E1167G probably damaging Het
Zfp763 T A 17: 33,019,595 D192V probably benign Het
Zfp853 T G 5: 143,288,869 Q332P unknown Het
Other mutations in C87499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:C87499 APN 4 88629070 missense probably benign 0.43
IGL00229:C87499 APN 4 88629053 missense probably damaging 0.99
IGL01938:C87499 APN 4 88629363 missense possibly damaging 0.90
IGL02321:C87499 APN 4 88630103 missense probably benign 0.33
IGL02351:C87499 APN 4 88627890 missense probably damaging 1.00
IGL02358:C87499 APN 4 88627890 missense probably damaging 1.00
P0005:C87499 UTSW 4 88627950 missense probably damaging 1.00
R0521:C87499 UTSW 4 88629322 missense probably damaging 0.96
R0578:C87499 UTSW 4 88634139 missense probably benign 0.01
R0600:C87499 UTSW 4 88629299 missense probably damaging 1.00
R0750:C87499 UTSW 4 88627668 missense probably benign 0.01
R1483:C87499 UTSW 4 88628834 missense probably damaging 1.00
R1502:C87499 UTSW 4 88628032 missense probably benign 0.00
R1911:C87499 UTSW 4 88630072 missense possibly damaging 0.93
R2204:C87499 UTSW 4 88628118 missense probably damaging 0.99
R2507:C87499 UTSW 4 88629211 missense possibly damaging 0.89
R2512:C87499 UTSW 4 88628958 missense probably damaging 0.99
R4299:C87499 UTSW 4 88628182 missense probably damaging 0.97
R4498:C87499 UTSW 4 88628892 unclassified probably null
R4656:C87499 UTSW 4 88629965 missense probably benign 0.41
R4787:C87499 UTSW 4 88629213 nonsense probably null
R4823:C87499 UTSW 4 88629215 missense probably damaging 1.00
R4885:C87499 UTSW 4 88627982 missense possibly damaging 0.50
R4948:C87499 UTSW 4 88628948 missense probably damaging 1.00
R4967:C87499 UTSW 4 88629195 missense probably damaging 1.00
R5229:C87499 UTSW 4 88630135 missense possibly damaging 0.92
R5520:C87499 UTSW 4 88630040 missense probably damaging 1.00
R5574:C87499 UTSW 4 88628043 missense probably benign 0.10
R5596:C87499 UTSW 4 88630055 missense probably damaging 1.00
R6282:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6366:C87499 UTSW 4 88628865 missense probably damaging 0.99
R6808:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6866:C87499 UTSW 4 88627740 missense probably damaging 1.00
R7105:C87499 UTSW 4 88630102 missense probably damaging 0.98
R7117:C87499 UTSW 4 88628958 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGACTATTCTCCACTGGC -3'
(R):5'- TGCAGAATGGGCATTTCCATG -3'

Sequencing Primer
(F):5'- ACTGGCTGCTTCTGTGTCAAC -3'
(R):5'- CATTTCCATGCATACCTGAAAGG -3'
Posted On2016-09-01