Incidental Mutation 'R0494:Bphl'
List |< first << previous [record 96 of 958] next >> last >|
ID42689
Institutional Source Beutler Lab
Gene Symbol Bphl
Ensembl Gene ENSMUSG00000038286
Gene Namebiphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen)
Synonyms
MMRRC Submission 038691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R0494 (G1)
Quality Score214
Status Validated
Chromosome13
Chromosomal Location34037597-34074074 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 34037771 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 37 (*37Q)
Ref Sequence ENSEMBL: ENSMUSP00000152050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021844] [ENSMUST00000040656] [ENSMUST00000167374] [ENSMUST00000222658] [ENSMUST00000222691]
Predicted Effect probably benign
Transcript: ENSMUST00000021844
SMART Domains Protein: ENSMUSP00000021844
Gene: ENSMUSG00000021408

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 286 1.2e-52 PFAM
Pfam:Pkinase 18 286 6.2e-51 PFAM
Pfam:Kinase-like 84 247 7.4e-8 PFAM
Pfam:RHIM 480 538 5.9e-10 PFAM
DEATH 558 654 1.2e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000040656
SMART Domains Protein: ENSMUSP00000046168
Gene: ENSMUSG00000038286

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Pfam:Hydrolase_4 57 208 1.1e-10 PFAM
Pfam:Abhydrolase_1 61 205 2.8e-22 PFAM
Pfam:Abhydrolase_5 62 273 3.9e-20 PFAM
Pfam:Abhydrolase_6 63 285 6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163843
Predicted Effect probably benign
Transcript: ENSMUST00000167374
SMART Domains Protein: ENSMUSP00000129831
Gene: ENSMUSG00000021408

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 17 286 5.2e-54 PFAM
Pfam:Pkinase 18 286 1.1e-53 PFAM
Pfam:RHIM 493 539 5.2e-16 PFAM
DEATH 558 654 1.2e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169557
Predicted Effect probably benign
Transcript: ENSMUST00000171137
SMART Domains Protein: ENSMUSP00000128511
Gene: ENSMUSG00000021408

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 116 2.6e-14 PFAM
Pfam:Pkinase 5 109 1.7e-14 PFAM
Pfam:Pkinase 92 227 2.9e-14 PFAM
Pfam:Pkinase_Tyr 94 227 2.9e-21 PFAM
Pfam:RHIM 421 479 2.3e-10 PFAM
DEATH 499 595 1.2e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221124
Predicted Effect probably null
Transcript: ENSMUST00000222658
AA Change: *37Q
Predicted Effect probably benign
Transcript: ENSMUST00000222691
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine protease family of hydrolytic enzymes which contain a serine in their active site. The encoded protein may play a role in activation of the antiviral prodrug valacyclovir. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik G A 5: 9,420,723 probably null Het
Aatf T C 11: 84,511,513 I116V probably benign Het
Abhd18 T C 3: 40,916,688 F94S probably damaging Het
Adam28 T A 14: 68,630,792 probably benign Het
Amn1 A T 6: 149,185,136 probably benign Het
Arhgap32 T C 9: 32,258,903 V993A probably damaging Het
Arhgap33 A T 7: 30,524,496 S703T probably damaging Het
Arhgef1 T C 7: 24,919,360 probably benign Het
Atg2a A G 19: 6,253,377 Y1083C probably damaging Het
Atp2a3 T C 11: 72,981,905 F760L probably damaging Het
B9d1 A G 11: 61,512,445 probably benign Het
Batf C T 12: 85,686,862 probably benign Het
BC051019 T A 7: 109,717,975 Y170F probably benign Het
Cab39l T C 14: 59,499,559 S43P probably damaging Het
Cad A G 5: 31,077,512 probably benign Het
Cct4 T G 11: 22,996,014 S119A probably benign Het
Cd163 G A 6: 124,311,449 V280M probably damaging Het
Cd86 A G 16: 36,618,637 probably benign Het
Cdh23 G A 10: 60,316,596 probably benign Het
Cdhr5 A G 7: 141,272,518 F145S probably damaging Het
Cdt1 T C 8: 122,572,060 S479P possibly damaging Het
Ces2g T C 8: 104,966,567 V372A probably benign Het
Chrna3 T C 9: 55,022,278 D92G probably damaging Het
Cndp1 A G 18: 84,619,533 S359P probably benign Het
Cops4 A G 5: 100,528,662 Q93R probably damaging Het
Dgka G C 10: 128,721,083 probably benign Het
Dmp1 A T 5: 104,212,208 D250V probably damaging Het
Dnajb2 C T 1: 75,239,634 probably benign Het
Dock9 T C 14: 121,662,584 T113A possibly damaging Het
Egln3 T A 12: 54,203,321 I81F probably benign Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Esco1 A T 18: 10,594,940 N115K probably benign Het
Fat1 A T 8: 44,950,542 N110I probably damaging Het
Fezf1 T A 6: 23,246,055 K370N probably damaging Het
Galnt18 T A 7: 111,554,564 K284N probably damaging Het
Glt8d1 C A 14: 31,011,623 T355K possibly damaging Het
Gm13083 G T 4: 143,616,156 V278F probably benign Het
Gm17455 G A 10: 60,403,235 R93H possibly damaging Het
Gng8 T A 7: 16,895,288 D46E probably benign Het
Gpx4 T C 10: 80,056,177 probably benign Het
Grk2 A T 19: 4,291,319 N189K probably damaging Het
Grm5 T C 7: 88,130,781 V1143A probably benign Het
Hibch A G 1: 52,902,896 E237G possibly damaging Het
Hipk2 C T 6: 38,729,989 A682T probably benign Het
Hmcn1 G T 1: 150,732,792 probably benign Het
Htt A G 5: 34,821,844 D857G possibly damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Igsf8 A G 1: 172,318,698 E421G probably benign Het
Kif26a T A 12: 112,179,471 probably null Het
Klhl26 T C 8: 70,451,601 Y519C probably damaging Het
Lamc1 A C 1: 153,246,936 probably null Het
Mical3 A T 6: 120,959,201 S1455T possibly damaging Het
Mitf G A 6: 97,994,429 G186S probably benign Het
Ms4a15 G A 19: 10,981,358 probably benign Het
Myo5b A G 18: 74,653,967 E481G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nbeal2 C A 9: 110,627,187 V1686L probably damaging Het
Nedd4l T G 18: 65,173,021 S335A possibly damaging Het
Nos1 A T 5: 117,905,474 N605Y probably damaging Het
Nyx C A X: 13,487,269 T454K probably benign Het
Olfr666 A G 7: 104,893,271 L119P probably damaging Het
Olfr972 T A 9: 39,873,402 N42K probably damaging Het
Pcdhb12 T A 18: 37,438,095 F765I probably benign Het
Pex3 C T 10: 13,527,788 G330R probably damaging Het
Pfkfb1 T C X: 150,634,613 Y339H probably damaging Het
Pias1 G A 9: 62,887,311 Q26* probably null Het
Pik3cg C A 12: 32,204,546 V481L possibly damaging Het
Plcg2 C T 8: 117,556,104 T108M probably damaging Het
Pon2 G A 6: 5,267,059 probably benign Het
Ppef2 A T 5: 92,253,093 probably benign Het
Ptpn22 A G 3: 103,860,455 K18E probably damaging Het
Pum2 C T 12: 8,721,736 Q360* probably null Het
Rab10 A C 12: 3,252,723 probably null Het
Ranbp2 T G 10: 58,467,432 S809A possibly damaging Het
Rbms2 A G 10: 128,133,670 V348A probably benign Het
Rnf213 A G 11: 119,426,012 E988G possibly damaging Het
Rnf213 A T 11: 119,443,120 M3052L probably damaging Het
Rpl14 C A 9: 120,574,362 probably benign Het
Rplp0 A G 5: 115,559,872 Y13C possibly damaging Het
Ryr1 A G 7: 29,003,793 probably benign Het
Sac3d1 T C 19: 6,118,294 E98G probably damaging Het
Scn10a T A 9: 119,624,100 D1242V probably damaging Het
Scnn1b T C 7: 121,899,458 Y74H probably damaging Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Sf3b4 C A 3: 96,173,701 D108E probably damaging Het
Shprh T C 10: 11,157,191 V307A probably damaging Het
Slc2a2 A G 3: 28,727,277 D458G probably benign Het
Spata5 G C 3: 37,432,163 D345H possibly damaging Het
Strc T C 2: 121,379,533 D103G probably damaging Het
Synrg T C 11: 84,019,543 I923T probably benign Het
Tango6 G T 8: 106,735,682 probably benign Het
Tas2r106 A G 6: 131,678,576 L104P probably damaging Het
Tat C T 8: 109,991,684 P67L probably damaging Het
Tln2 A C 9: 67,355,197 S593A probably benign Het
Tmem94 A G 11: 115,794,781 probably null Het
Tppp3 G A 8: 105,468,172 A109V probably benign Het
Trank1 T C 9: 111,391,293 F2366S probably benign Het
Trpc5 T A X: 144,481,396 Y155F probably damaging Het
Trpv1 A G 11: 73,260,442 T451A probably benign Het
Ttc9 C A 12: 81,631,649 A82E probably damaging Het
Ttll11 T A 2: 35,944,874 N180I probably damaging Het
Ttn T C 2: 76,736,399 N28050S possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Wnt3 G A 11: 103,812,315 C208Y probably damaging Het
Zfp521 C A 18: 13,845,268 C696F probably damaging Het
Zfp521 T C 18: 13,846,870 D162G probably damaging Het
Zfp869 A T 8: 69,706,404 H506Q probably damaging Het
Other mutations in Bphl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Bphl APN 13 34063997 missense probably damaging 1.00
IGL03087:Bphl APN 13 34073711 missense probably damaging 1.00
R0127:Bphl UTSW 13 34064046 unclassified probably benign
R1475:Bphl UTSW 13 34060524 missense probably benign
R5862:Bphl UTSW 13 34063984 missense possibly damaging 0.87
R6849:Bphl UTSW 13 34050269 splice site probably null
X0009:Bphl UTSW 13 34037763 missense probably benign 0.06
X0010:Bphl UTSW 13 34037763 missense probably benign 0.06
X0011:Bphl UTSW 13 34037763 missense probably benign 0.06
X0014:Bphl UTSW 13 34037763 missense probably benign 0.06
X0017:Bphl UTSW 13 34037763 missense probably benign 0.06
X0021:Bphl UTSW 13 34037763 missense probably benign 0.06
X0023:Bphl UTSW 13 34037763 missense probably benign 0.06
X0033:Bphl UTSW 13 34037763 missense probably benign 0.06
X0064:Bphl UTSW 13 34037763 missense probably benign 0.06
X0067:Bphl UTSW 13 34037763 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTGAACTGTCCACCCTGAGAGAG -3'
(R):5'- TTCCCAGCAAATGGCTAAGAGGC -3'

Sequencing Primer
(F):5'- TCGAGCTTAGCACTTGAAGG -3'
(R):5'- TAAGAGGCCAGCAAGCCC -3'
Posted On2013-05-23