Incidental Mutation 'R5427:Atg4b'
ID426933
Institutional Source Beutler Lab
Gene Symbol Atg4b
Ensembl Gene ENSMUSG00000026280
Gene Nameautophagy related 4B, cysteine peptidase
Synonyms2510009N07Rik, autophagin 1, Apg4b
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93751500-93790610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 93775206 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 119 (K119N)
Ref Sequence ENSEMBL: ENSMUSP00000027502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027502] [ENSMUST00000149436] [ENSMUST00000185482] [ENSMUST00000187824]
Predicted Effect probably damaging
Transcript: ENSMUST00000027502
AA Change: K119N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027502
Gene: ENSMUSG00000026280
AA Change: K119N

DomainStartEndE-ValueType
Pfam:Peptidase_C54 39 335 4.4e-104 PFAM
low complexity region 375 393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135762
Predicted Effect possibly damaging
Transcript: ENSMUST00000149436
AA Change: K122N

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123383
Gene: ENSMUSG00000026280
AA Change: K122N

DomainStartEndE-ValueType
Pfam:Peptidase_C54 42 150 6.9e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185482
AA Change: K119N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140758
Gene: ENSMUSG00000026280
AA Change: K119N

DomainStartEndE-ValueType
Pfam:Peptidase_C54 36 137 2.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186001
Predicted Effect probably damaging
Transcript: ENSMUST00000187824
AA Change: K86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139541
Gene: ENSMUSG00000026280
AA Change: K86N

DomainStartEndE-ValueType
Pfam:Peptidase_C54 61 121 1.5e-16 PFAM
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased autophagy, impaired swimming, circling, head tilting, and abnormal utricle, saccular, and otolith morphology. Mice homozygous for another gene trap allele exhibit partial preweaning lethality and impaired motor coordination and learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably benign Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 Y212C probably benign Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S359C probably damaging Het
Diaph1 A T 18: 37,890,595 V739E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably benign Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1523P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G511R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Atg4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Atg4b APN 1 93785904 unclassified probably benign
IGL01875:Atg4b APN 1 93778310 missense probably damaging 1.00
IGL02884:Atg4b APN 1 93787715 missense probably benign
R0050:Atg4b UTSW 1 93787718 missense probably benign
R0050:Atg4b UTSW 1 93787718 missense probably benign
R0387:Atg4b UTSW 1 93786556 missense probably benign 0.02
R0533:Atg4b UTSW 1 93784910 splice site probably benign
R2382:Atg4b UTSW 1 93784842 missense probably damaging 1.00
R3113:Atg4b UTSW 1 93775704 splice site probably benign
R3730:Atg4b UTSW 1 93768275 missense probably damaging 0.99
R4303:Atg4b UTSW 1 93768262 missense probably benign 0.02
R4612:Atg4b UTSW 1 93786541 missense probably damaging 1.00
R5027:Atg4b UTSW 1 93786575 missense probably benign 0.00
R5048:Atg4b UTSW 1 93775658 missense possibly damaging 0.75
R5735:Atg4b UTSW 1 93773797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAATCCTGGCAGATTTGAC -3'
(R):5'- ACTCACTGCAGGCTGTACAG -3'

Sequencing Primer
(F):5'- ATCCTGGCAGATTTGACTTCTAAC -3'
(R):5'- GCTAGTGCTGGAACACCC -3'
Posted OnSep 01, 2016