Incidental Mutation 'R5427:Rgs1'
ID426935
Institutional Source Beutler Lab
Gene Symbol Rgs1
Ensembl Gene ENSMUSG00000026358
Gene Nameregulator of G-protein signaling 1
SynonymsBL34
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location144242296-144249242 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 144246280 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 118 (C118*)
Ref Sequence ENSEMBL: ENSMUSP00000140624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167317] [ENSMUST00000169409] [ENSMUST00000172388] [ENSMUST00000185714] [ENSMUST00000189061]
Predicted Effect probably benign
Transcript: ENSMUST00000167317
Predicted Effect probably benign
Transcript: ENSMUST00000167812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169042
Predicted Effect probably benign
Transcript: ENSMUST00000169409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170870
Predicted Effect probably benign
Transcript: ENSMUST00000172388
SMART Domains Protein: ENSMUSP00000130339
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185714
AA Change: C91*
SMART Domains Protein: ENSMUSP00000140902
Gene: ENSMUSG00000026358
AA Change: C91*

DomainStartEndE-ValueType
RGS 58 128 2.8e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189061
AA Change: C118*
SMART Domains Protein: ENSMUSP00000140624
Gene: ENSMUSG00000026358
AA Change: C118*

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189916
Meta Mutation Damage Score 0.716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased splenic B cell germinal centers, increased chemotactic responses in B cells and immature dendritic cells, and decreased antibody secreting cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Rgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Rgs1 APN 1 144245378 missense probably damaging 1.00
R0106:Rgs1 UTSW 1 144248549 missense probably benign 0.31
R0106:Rgs1 UTSW 1 144248549 missense probably benign 0.31
R0149:Rgs1 UTSW 1 144249087 start gained probably benign
R0295:Rgs1 UTSW 1 144245486 missense probably damaging 1.00
R0833:Rgs1 UTSW 1 144247933 missense probably damaging 1.00
R0836:Rgs1 UTSW 1 144247933 missense probably damaging 1.00
R1585:Rgs1 UTSW 1 144245489 critical splice acceptor site probably null
R4373:Rgs1 UTSW 1 144247906 missense probably benign 0.00
R4375:Rgs1 UTSW 1 144247906 missense probably benign 0.00
R4769:Rgs1 UTSW 1 144247929 missense probably damaging 1.00
R4961:Rgs1 UTSW 1 144248571 splice site probably null
R4992:Rgs1 UTSW 1 144246322 missense probably damaging 1.00
R5614:Rgs1 UTSW 1 144246257 missense probably benign 0.18
R5743:Rgs1 UTSW 1 144245372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATGGCTCCACTGAAGTG -3'
(R):5'- AGCCAACTTGTACCTTTGTGC -3'

Sequencing Primer
(F):5'- GCAAAACTATGATACCACGGATTTCG -3'
(R):5'- CCCTCTTATTTTAGCAGGTCA -3'
Posted On2016-09-01