Incidental Mutation 'R5427:Pi4kb'
ID426940
Institutional Source Beutler Lab
Gene Symbol Pi4kb
Ensembl Gene ENSMUSG00000038861
Gene Namephosphatidylinositol 4-kinase beta
SynonymsESTM41, Pik4cb
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94974731-95006843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94994207 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 395 (D395G)
Ref Sequence ENSEMBL: ENSMUSP00000119833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000133297] [ENSMUST00000138209] [ENSMUST00000167008]
Predicted Effect probably benign
Transcript: ENSMUST00000072287
AA Change: D395G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861
AA Change: D395G

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
AA Change: D410G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861
AA Change: D410G

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
AA Change: D422G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861
AA Change: D422G

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133297
SMART Domains Protein: ENSMUSP00000123529
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 1 225 7.13e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135483
Predicted Effect probably benign
Transcript: ENSMUST00000138209
AA Change: D78G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143287
Predicted Effect probably benign
Transcript: ENSMUST00000167008
AA Change: D78G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861
AA Change: D78G

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 Y212C probably benign Het
Atg4b G C 1: 93,775,206 K119N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S359C probably damaging Het
Diaph1 A T 18: 37,890,595 V739E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1523P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G511R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Pi4kb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Pi4kb APN 3 95004263 missense probably damaging 1.00
IGL01559:Pi4kb APN 3 94984129 missense probably benign 0.00
IGL03003:Pi4kb APN 3 94984812 missense probably benign 0.00
IGL03087:Pi4kb APN 3 94984764 missense probably benign
R0014:Pi4kb UTSW 3 94998897 missense probably damaging 1.00
R0196:Pi4kb UTSW 3 94998950 missense probably damaging 1.00
R0387:Pi4kb UTSW 3 94984740 missense probably benign 0.42
R0394:Pi4kb UTSW 3 94996804 intron probably benign
R0394:Pi4kb UTSW 3 94996805 intron probably benign
R1485:Pi4kb UTSW 3 94994387 missense probably damaging 0.99
R3700:Pi4kb UTSW 3 94994288 missense probably benign 0.09
R4449:Pi4kb UTSW 3 94984735 missense probably benign 0.41
R4502:Pi4kb UTSW 3 94996607 missense probably benign 0.02
R4717:Pi4kb UTSW 3 94998851 missense probably damaging 1.00
R4737:Pi4kb UTSW 3 95004338 missense probably damaging 1.00
R4763:Pi4kb UTSW 3 95004409 intron probably benign
R5322:Pi4kb UTSW 3 94994249 missense probably benign 0.04
R5622:Pi4kb UTSW 3 94998861 missense possibly damaging 0.56
R5625:Pi4kb UTSW 3 94984677 missense probably benign 0.15
R5755:Pi4kb UTSW 3 94994297 unclassified probably null
R5926:Pi4kb UTSW 3 94998996 missense probably damaging 1.00
Z1088:Pi4kb UTSW 3 94984509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTGATGATAAGCTCAG -3'
(R):5'- ACTTGCAGCTCGCCTATATC -3'

Sequencing Primer
(F):5'- TGATAAGCTCAGAGGCATGTACACC -3'
(R):5'- GCCTATATCATCCACTGACCAGG -3'
Posted OnSep 01, 2016