Incidental Mutation 'R5427:Zfp788'
ID426952
Institutional Source Beutler Lab
Gene Symbol Zfp788
Ensembl Gene ENSMUSG00000074165
Gene Namezinc finger protein 788
Synonyms
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41633203-41651530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41649652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 571 (V571I)
Ref Sequence ENSEMBL: ENSMUSP00000096108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045720] [ENSMUST00000098508] [ENSMUST00000100275] [ENSMUST00000131180] [ENSMUST00000140964] [ENSMUST00000154942] [ENSMUST00000170770]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045720
AA Change: V551I

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035499
Gene: ENSMUSG00000074165
AA Change: V551I

DomainStartEndE-ValueType
KRAB 4 67 7.82e-17 SMART
ZnF_C2H2 218 240 2.53e-2 SMART
ZnF_C2H2 246 268 2.71e-2 SMART
ZnF_C2H2 274 296 8.47e-4 SMART
ZnF_C2H2 302 324 3.16e-3 SMART
ZnF_C2H2 330 352 1.38e-3 SMART
ZnF_C2H2 358 380 4.54e-4 SMART
ZnF_C2H2 386 408 1.36e-2 SMART
ZnF_C2H2 414 436 2.24e-3 SMART
ZnF_C2H2 442 464 5.14e-3 SMART
ZnF_C2H2 470 492 5.14e-3 SMART
ZnF_C2H2 498 520 5.42e-2 SMART
ZnF_C2H2 526 548 8.6e-5 SMART
ZnF_C2H2 554 576 1.53e-1 SMART
ZnF_C2H2 582 604 2.4e-3 SMART
ZnF_C2H2 610 632 8.81e-2 SMART
ZnF_C2H2 638 660 9.58e-3 SMART
ZnF_C2H2 666 688 4.54e-4 SMART
ZnF_C2H2 694 716 1.1e-2 SMART
ZnF_C2H2 722 744 3.63e-3 SMART
ZnF_C2H2 750 772 8.94e-3 SMART
ZnF_C2H2 778 800 1.5e-4 SMART
ZnF_C2H2 806 828 4.24e-4 SMART
ZnF_C2H2 834 856 5.06e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098508
AA Change: V571I

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096108
Gene: ENSMUSG00000074165
AA Change: V571I

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
ZnF_C2H2 238 260 2.53e-2 SMART
ZnF_C2H2 266 288 2.71e-2 SMART
ZnF_C2H2 294 316 8.47e-4 SMART
ZnF_C2H2 322 344 3.16e-3 SMART
ZnF_C2H2 350 372 1.38e-3 SMART
ZnF_C2H2 378 400 4.54e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 2.24e-3 SMART
ZnF_C2H2 462 484 5.14e-3 SMART
ZnF_C2H2 490 512 5.14e-3 SMART
ZnF_C2H2 518 540 5.42e-2 SMART
ZnF_C2H2 546 568 8.6e-5 SMART
ZnF_C2H2 574 596 1.53e-1 SMART
ZnF_C2H2 602 624 2.4e-3 SMART
ZnF_C2H2 630 652 8.81e-2 SMART
ZnF_C2H2 658 680 9.58e-3 SMART
ZnF_C2H2 686 708 4.54e-4 SMART
ZnF_C2H2 714 736 1.1e-2 SMART
ZnF_C2H2 742 764 3.63e-3 SMART
ZnF_C2H2 770 792 8.94e-3 SMART
ZnF_C2H2 798 820 1.5e-4 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
ZnF_C2H2 854 876 5.06e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100275
AA Change: V519I

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097847
Gene: ENSMUSG00000074165
AA Change: V519I

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131180
SMART Domains Protein: ENSMUSP00000114542
Gene: ENSMUSG00000074165

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140964
SMART Domains Protein: ENSMUSP00000116050
Gene: ENSMUSG00000074165

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154942
Predicted Effect possibly damaging
Transcript: ENSMUST00000170770
AA Change: V519I

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132848
Gene: ENSMUSG00000074165
AA Change: V519I

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Zfp788
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0207:Zfp788 UTSW 7 41649596 missense probably damaging 1.00
R0320:Zfp788 UTSW 7 41649547 missense probably damaging 1.00
R0608:Zfp788 UTSW 7 41648281 missense possibly damaging 0.53
R1184:Zfp788 UTSW 7 41648326 missense probably damaging 1.00
R1483:Zfp788 UTSW 7 41649075 nonsense probably null
R1985:Zfp788 UTSW 7 41650481 missense probably damaging 0.98
R2030:Zfp788 UTSW 7 41649560 missense probably damaging 1.00
R2207:Zfp788 UTSW 7 41649640 missense probably damaging 0.99
R2313:Zfp788 UTSW 7 41648888 missense probably damaging 0.99
R3791:Zfp788 UTSW 7 41649728 missense probably damaging 0.99
R3872:Zfp788 UTSW 7 41649444 nonsense probably null
R4126:Zfp788 UTSW 7 41649436 missense probably damaging 0.97
R4579:Zfp788 UTSW 7 41647594 missense probably benign 0.00
R4833:Zfp788 UTSW 7 41647568 missense probably benign 0.31
R5076:Zfp788 UTSW 7 41648584 missense possibly damaging 0.93
R5175:Zfp788 UTSW 7 41649329 missense probably damaging 1.00
R5225:Zfp788 UTSW 7 41649556 missense probably benign 0.16
R5364:Zfp788 UTSW 7 41650127 missense probably damaging 1.00
R5484:Zfp788 UTSW 7 41649853 missense probably damaging 0.96
R5659:Zfp788 UTSW 7 41650116 nonsense probably null
R5917:Zfp788 UTSW 7 41649148 missense probably benign
R6064:Zfp788 UTSW 7 41648454 missense probably benign 0.18
R6128:Zfp788 UTSW 7 41650361 missense probably damaging 1.00
R6144:Zfp788 UTSW 7 41649769 missense probably damaging 0.97
R6182:Zfp788 UTSW 7 41650516 missense probably damaging 0.98
R6299:Zfp788 UTSW 7 41648541 missense possibly damaging 0.81
R6823:Zfp788 UTSW 7 41649560 missense probably damaging 1.00
R6974:Zfp788 UTSW 7 41649877 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGGAAAGCGTTCAGGCG -3'
(R):5'- AGGACCTGTCACACTGTTTAC -3'

Sequencing Primer
(F):5'- GATTTGCAGCAAAGCCTTCG -3'
(R):5'- CATTCATAGAGGTTTTTCCCAGTG -3'
Posted On2016-09-01