Incidental Mutation 'R5427:Palld'
ID426959
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Namepalladin, cytoskeletal associated protein
Synonyms2410003B16Rik
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5427 (G1)
Quality Score201
Status Validated
Chromosome8
Chromosomal Location61511433-61902690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61550072 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 720 (C720Y)
Ref Sequence ENSEMBL: ENSMUSP00000112442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]
Predicted Effect probably benign
Transcript: ENSMUST00000034057
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121200
SMART Domains Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
low complexity region 37 68 N/A INTRINSIC
low complexity region 77 112 N/A INTRINSIC
IGc2 293 362 3.1e-9 SMART
low complexity region 378 403 N/A INTRINSIC
IGc2 427 495 4.92e-12 SMART
IGc2 526 595 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121493
AA Change: C331Y
SMART Domains Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: C331Y

DomainStartEndE-ValueType
IGc2 71 146 1.6e-11 SMART
low complexity region 250 284 N/A INTRINSIC
low complexity region 298 326 N/A INTRINSIC
low complexity region 376 407 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
IGc2 632 701 3.1e-9 SMART
low complexity region 717 742 N/A INTRINSIC
IGc2 766 834 4.92e-12 SMART
IGc2 865 934 1.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121785
AA Change: C720Y

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: C720Y

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135439
SMART Domains Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 82 151 3.1e-9 SMART
low complexity region 167 192 N/A INTRINSIC
IGc2 216 284 4.92e-12 SMART
internal_repeat_1 302 336 1.47e-9 PROSPERO
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61515935 missense possibly damaging 0.77
IGL01083:Palld APN 8 61538807 missense probably benign 0.44
IGL01644:Palld APN 8 61877478 missense probably benign 0.28
IGL01672:Palld APN 8 61877502 missense probably benign 0.22
IGL01941:Palld APN 8 61535700 missense probably benign 0.44
IGL02037:Palld APN 8 61525114 missense probably damaging 1.00
IGL02126:Palld APN 8 61877442 missense possibly damaging 0.82
IGL02537:Palld APN 8 61684934 missense probably benign 0.05
IGL02632:Palld APN 8 61515245 missense probably damaging 1.00
IGL02809:Palld APN 8 61515247 missense probably damaging 1.00
IGL02901:Palld APN 8 61876995 nonsense probably null
IGL03400:Palld APN 8 61513455 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0745:Palld UTSW 8 61877703 missense probably damaging 1.00
R1263:Palld UTSW 8 61513457 frame shift probably null
R1342:Palld UTSW 8 61522882 critical splice donor site probably null
R1893:Palld UTSW 8 61516621 missense probably damaging 1.00
R2017:Palld UTSW 8 61684765 missense probably damaging 0.99
R2102:Palld UTSW 8 61533433 missense possibly damaging 0.82
R2129:Palld UTSW 8 61877361 missense probably benign 0.00
R2246:Palld UTSW 8 61877135 missense probably benign 0.01
R3545:Palld UTSW 8 61550078 missense possibly damaging 0.95
R3815:Palld UTSW 8 61549837 intron probably benign
R3824:Palld UTSW 8 61709033 missense probably damaging 1.00
R4412:Palld UTSW 8 61687372 missense probably damaging 0.98
R4781:Palld UTSW 8 61877028 missense probably benign 0.01
R4836:Palld UTSW 8 61687381 missense probably benign 0.11
R4871:Palld UTSW 8 61549781 intron probably benign
R4963:Palld UTSW 8 61703210 missense probably damaging 1.00
R5036:Palld UTSW 8 61550162 missense probably damaging 1.00
R5128:Palld UTSW 8 61720588 missense probably damaging 1.00
R5343:Palld UTSW 8 61549815 intron probably benign
R5421:Palld UTSW 8 61516550 missense probably damaging 1.00
R5561:Palld UTSW 8 61516585 missense probably damaging 1.00
R5651:Palld UTSW 8 61538788 missense probably damaging 1.00
R5679:Palld UTSW 8 61684945 missense possibly damaging 0.95
R5915:Palld UTSW 8 61533352 critical splice donor site probably null
R6153:Palld UTSW 8 61550152 missense probably damaging 1.00
R6276:Palld UTSW 8 61513423 missense probably damaging 1.00
R6323:Palld UTSW 8 61720693 missense probably damaging 1.00
R6659:Palld UTSW 8 61533443 missense probably benign 0.28
R7016:Palld UTSW 8 61515998 missense probably damaging 1.00
R7124:Palld UTSW 8 61516645 missense unknown
R7145:Palld UTSW 8 61532017 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAATGGTGACGGCAAGCTG -3'
(R):5'- GGATGTGCCCCTTCTCTAAAGTTG -3'

Sequencing Primer
(F):5'- TGACGGCAAGCTGGAGGAG -3'
(R):5'- CTCTCTGTGTCCCCAGGG -3'
Posted On2016-09-01