Incidental Mutation 'R5427:Zfp709'
ID426962
Institutional Source Beutler Lab
Gene Symbol Zfp709
Ensembl Gene ENSMUSG00000056019
Gene Namezinc finger protein 709
SynonymsGIOT-4
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71882019-71895727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71889132 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 135 (E135G)
Ref Sequence ENSEMBL: ENSMUSP00000140285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034259] [ENSMUST00000188374] [ENSMUST00000188685]
Predicted Effect probably benign
Transcript: ENSMUST00000034259
AA Change: E134G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034259
Gene: ENSMUSG00000056019
AA Change: E134G

DomainStartEndE-ValueType
KRAB 3 68 3.08e-15 SMART
ZnF_C2H2 224 246 6.78e-3 SMART
ZnF_C2H2 252 274 2.09e-3 SMART
ZnF_C2H2 280 302 2.05e-2 SMART
ZnF_C2H2 308 330 2.4e-3 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 392 414 1.69e-3 SMART
ZnF_C2H2 420 442 5.14e-3 SMART
ZnF_C2H2 448 470 1.67e-2 SMART
ZnF_C2H2 476 498 1.1e-2 SMART
ZnF_C2H2 504 526 2.86e-1 SMART
ZnF_C2H2 532 554 7.26e-3 SMART
ZnF_C2H2 560 582 8.34e-3 SMART
ZnF_C2H2 588 610 1.5e-4 SMART
ZnF_C2H2 616 638 1.18e-2 SMART
ZnF_C2H2 644 666 1.06e-4 SMART
ZnF_C2H2 672 694 1.18e-2 SMART
ZnF_C2H2 700 722 8.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188374
SMART Domains Protein: ENSMUSP00000141000
Gene: ENSMUSG00000056019

DomainStartEndE-ValueType
KRAB 4 56 9.2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188685
AA Change: E135G

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140285
Gene: ENSMUSG00000056019
AA Change: E135G

DomainStartEndE-ValueType
KRAB 4 69 3.08e-15 SMART
ZnF_C2H2 225 247 6.78e-3 SMART
ZnF_C2H2 253 275 2.09e-3 SMART
ZnF_C2H2 281 303 2.05e-2 SMART
ZnF_C2H2 309 331 2.4e-3 SMART
ZnF_C2H2 337 359 1.36e-2 SMART
ZnF_C2H2 365 387 1.36e-2 SMART
ZnF_C2H2 393 415 1.69e-3 SMART
ZnF_C2H2 421 443 5.14e-3 SMART
ZnF_C2H2 449 471 1.67e-2 SMART
ZnF_C2H2 477 499 1.1e-2 SMART
ZnF_C2H2 505 527 2.86e-1 SMART
ZnF_C2H2 533 555 7.26e-3 SMART
ZnF_C2H2 561 583 8.34e-3 SMART
ZnF_C2H2 589 611 1.5e-4 SMART
ZnF_C2H2 617 639 1.18e-2 SMART
ZnF_C2H2 645 667 1.06e-4 SMART
ZnF_C2H2 673 695 1.18e-2 SMART
ZnF_C2H2 701 723 8.94e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203585
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Zfp709
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03174:Zfp709 APN 8 71889026 missense probably benign 0.03
IGL03187:Zfp709 APN 8 71889282 missense probably benign 0.41
R0336:Zfp709 UTSW 8 71890605 missense probably damaging 1.00
R1386:Zfp709 UTSW 8 71890662 missense probably damaging 0.99
R1878:Zfp709 UTSW 8 71890047 missense probably damaging 1.00
R2279:Zfp709 UTSW 8 71889090 missense probably benign 0.31
R2320:Zfp709 UTSW 8 71887292 missense probably damaging 1.00
R2885:Zfp709 UTSW 8 71889705 missense probably benign 0.08
R3833:Zfp709 UTSW 8 71889062 missense probably benign 0.00
R3926:Zfp709 UTSW 8 71890553 missense probably damaging 1.00
R4165:Zfp709 UTSW 8 71890805 nonsense probably null
R4179:Zfp709 UTSW 8 71889906 missense probably damaging 1.00
R4963:Zfp709 UTSW 8 71889788 missense probably benign 0.27
R5340:Zfp709 UTSW 8 71889752 missense probably damaging 1.00
R5513:Zfp709 UTSW 8 71890056 missense probably damaging 1.00
R5639:Zfp709 UTSW 8 71889991 unclassified probably null
R5692:Zfp709 UTSW 8 71890155 missense probably damaging 1.00
R5872:Zfp709 UTSW 8 71889519 missense probably benign 0.03
R5940:Zfp709 UTSW 8 71890220 missense possibly damaging 0.85
R6192:Zfp709 UTSW 8 71890708 small deletion probably benign
R6210:Zfp709 UTSW 8 71890708 small deletion probably benign
R6225:Zfp709 UTSW 8 71890708 small deletion probably benign
R6227:Zfp709 UTSW 8 71890708 small deletion probably benign
R6228:Zfp709 UTSW 8 71890708 small deletion probably benign
R6246:Zfp709 UTSW 8 71890708 small deletion probably benign
R6247:Zfp709 UTSW 8 71890708 small deletion probably benign
R6248:Zfp709 UTSW 8 71890708 small deletion probably benign
R6249:Zfp709 UTSW 8 71890708 small deletion probably benign
R6250:Zfp709 UTSW 8 71890708 small deletion probably benign
R6258:Zfp709 UTSW 8 71890708 small deletion probably benign
R6259:Zfp709 UTSW 8 71890708 small deletion probably benign
R6371:Zfp709 UTSW 8 71889485 missense probably damaging 1.00
R6875:Zfp709 UTSW 8 71889007 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGGAGCATAGCAAAGGTACTG -3'
(R):5'- CAGGGTAATTAAAGGCATAATGCTGC -3'

Sequencing Primer
(F):5'- GCATAGCAAAGGTACTGAAAGTAAAG -3'
(R):5'- AAGGCATAATGCTGCTTATCTATAC -3'
Posted On2016-09-01