Incidental Mutation 'R5427:Bbx'
ID426980
Institutional Source Beutler Lab
Gene Symbol Bbx
Ensembl Gene ENSMUSG00000022641
Gene Namebobby sox HMG box containing
Synonyms5730403O13Rik, 5530401J07Rik
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location50191844-50432390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50280497 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 12 (T12A)
Ref Sequence ENSEMBL: ENSMUSP00000110132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066037] [ENSMUST00000089399] [ENSMUST00000089404] [ENSMUST00000114477] [ENSMUST00000114488] [ENSMUST00000138166]
Predicted Effect probably benign
Transcript: ENSMUST00000066037
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066384
Gene: ENSMUSG00000022641
AA Change: T12A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
Pfam:DUF2028 109 150 3.1e-22 PFAM
Pfam:DUF2028 140 214 4.4e-26 PFAM
low complexity region 216 230 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 415 432 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 561 566 N/A INTRINSIC
low complexity region 780 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089399
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086821
Gene: ENSMUSG00000022641
AA Change: T12A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 2.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089404
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086826
Gene: ENSMUSG00000022641
AA Change: T12A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.7e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114477
SMART Domains Protein: ENSMUSP00000110121
Gene: ENSMUSG00000022641

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 6.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114488
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110132
Gene: ENSMUSG00000022641
AA Change: T12A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131695
Predicted Effect probably benign
Transcript: ENSMUST00000138166
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119238
Gene: ENSMUSG00000022641
AA Change: T12A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 335 9.2e-54 PFAM
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Meta Mutation Damage Score 0.0924 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show increased IgA level, abnormal tooth morphology, and a reduction in heart weight, lean body mass, body length, long bone length, bone mineral density, and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably benign Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 Y212C probably benign Het
Atg4b G C 1: 93,775,206 K119N probably damaging Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S359C probably damaging Het
Diaph1 A T 18: 37,890,595 V739E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably benign Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1523P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G511R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Bbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Bbx APN 16 50202513 missense probably benign 0.08
IGL01544:Bbx APN 16 50274777 nonsense probably null
IGL02073:Bbx APN 16 50202491 missense probably damaging 1.00
IGL02302:Bbx APN 16 50224915 missense probably damaging 1.00
IGL02566:Bbx APN 16 50223240 unclassified probably benign
IGL02618:Bbx APN 16 50247798 missense probably damaging 1.00
IGL03187:Bbx APN 16 50274563 missense probably damaging 0.96
IGL03215:Bbx APN 16 50202572 missense probably damaging 1.00
IGL03295:Bbx APN 16 50224564 missense probably damaging 1.00
R0024:Bbx UTSW 16 50224918 missense probably benign
R0024:Bbx UTSW 16 50224918 missense probably benign
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0143:Bbx UTSW 16 50280392 missense probably benign 0.32
R0144:Bbx UTSW 16 50280392 missense probably benign 0.32
R0374:Bbx UTSW 16 50280392 missense probably benign 0.32
R0532:Bbx UTSW 16 50266284 missense probably damaging 1.00
R0550:Bbx UTSW 16 50274533 splice site probably benign
R0762:Bbx UTSW 16 50225166 missense possibly damaging 0.94
R0881:Bbx UTSW 16 50220600 splice site probably benign
R1448:Bbx UTSW 16 50266270 nonsense probably null
R1916:Bbx UTSW 16 50266245 missense probably damaging 1.00
R1983:Bbx UTSW 16 50209117 missense possibly damaging 0.62
R2006:Bbx UTSW 16 50224395 missense possibly damaging 0.93
R2095:Bbx UTSW 16 50224689 missense possibly damaging 0.88
R2145:Bbx UTSW 16 50274544 splice site probably benign
R2475:Bbx UTSW 16 50220519 missense probably damaging 0.99
R2892:Bbx UTSW 16 50224741 missense probably damaging 1.00
R4130:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4177:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4486:Bbx UTSW 16 50200414 missense probably damaging 1.00
R4989:Bbx UTSW 16 50224738 missense probably damaging 1.00
R5005:Bbx UTSW 16 50266351 missense probably damaging 1.00
R5582:Bbx UTSW 16 50223356 missense probably damaging 1.00
R6063:Bbx UTSW 16 50251367 missense probably benign
R6216:Bbx UTSW 16 50251388 missense probably benign 0.00
R6246:Bbx UTSW 16 50224660 missense probably benign 0.04
R6618:Bbx UTSW 16 50266263 missense probably damaging 1.00
X0021:Bbx UTSW 16 50247805 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGACGGATTCCTTGTGCTC -3'
(R):5'- CCAGTAAATGTGTGAGCTGATAGATG -3'

Sequencing Primer
(F):5'- AGACGGATTCCTTGTGCTCTAAAC -3'
(R):5'- AATGTGTGAGCTGATAGATGGTTTAG -3'
Posted OnSep 01, 2016