Incidental Mutation 'R5427:Fam89b'
ID426982
Institutional Source Beutler Lab
Gene Symbol Fam89b
Ensembl Gene ENSMUSG00000024939
Gene Namefamily with sequence similarity 89, member B
SynonymsMtvr2, 1110021A21Rik, Fam89b
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5728087-5729653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5728791 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 127 (S127P)
Ref Sequence ENSEMBL: ENSMUSP00000112257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025885] [ENSMUST00000049295] [ENSMUST00000075606] [ENSMUST00000099955] [ENSMUST00000116558] [ENSMUST00000159693] [ENSMUST00000160852] [ENSMUST00000161368]
Predicted Effect probably benign
Transcript: ENSMUST00000025885
SMART Domains Protein: ENSMUSP00000025885
Gene: ENSMUSG00000079478

DomainStartEndE-ValueType
Pfam:Auto_anti-p27 36 74 2.8e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049295
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075606
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Predicted Effect silent
Transcript: ENSMUST00000099955
SMART Domains Protein: ENSMUSP00000097538
Gene: ENSMUSG00000024939

DomainStartEndE-ValueType
low complexity region 9 37 N/A INTRINSIC
Pfam:LURAP 70 152 3.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116558
AA Change: S127P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112257
Gene: ENSMUSG00000024939
AA Change: S127P

DomainStartEndE-ValueType
low complexity region 9 37 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159008
Predicted Effect probably benign
Transcript: ENSMUST00000159693
SMART Domains Protein: ENSMUSP00000123867
Gene: ENSMUSG00000079478

DomainStartEndE-ValueType
Pfam:Auto_anti-p27 33 59 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160141
Predicted Effect probably benign
Transcript: ENSMUST00000160852
SMART Domains Protein: ENSMUSP00000125570
Gene: ENSMUSG00000079478

DomainStartEndE-ValueType
Pfam:Auto_anti-p27 36 74 2.8e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000161368
SMART Domains Protein: ENSMUSP00000124294
Gene: ENSMUSG00000024939

DomainStartEndE-ValueType
low complexity region 9 37 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 138 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162407
Predicted Effect probably benign
Transcript: ENSMUST00000162976
SMART Domains Protein: ENSMUSP00000125679
Gene: ENSMUSG00000079478

DomainStartEndE-ValueType
Pfam:Auto_anti-p27 1 28 1.3e-13 PFAM
Meta Mutation Damage Score 0.1676 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Tssk2 A G 16: 17,898,865 D44G probably damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Fam89b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Fam89b APN 19 5729369 missense probably benign 0.00
IGL02323:Fam89b APN 19 5728871 unclassified probably null
R1475:Fam89b UTSW 19 5729419 missense probably damaging 0.98
R3432:Fam89b UTSW 19 5731733 unclassified probably null
R4770:Fam89b UTSW 19 5729454 missense probably damaging 0.98
R5393:Fam89b UTSW 19 5728705 missense probably damaging 1.00
R5408:Fam89b UTSW 19 5729393 nonsense probably null
R6376:Fam89b UTSW 19 5728729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGCAACCACTGGTCAC -3'
(R):5'- AGGTTTCACAGTTGGCAAGTAC -3'

Sequencing Primer
(F):5'- ACTGGTCACGGGCATTG -3'
(R):5'- GGCAAGTACCATCTGTTCTCAG -3'
Posted On2016-09-01