Incidental Mutation 'R5428:Colgalt1'
ID427015
Institutional Source Beutler Lab
Gene Symbol Colgalt1
Ensembl Gene ENSMUSG00000034807
Gene Namecollagen beta(1-O)galactosyltransferase 1
SynonymsGlt25d1, 2810024B22Rik
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5428 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71610998-71624911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71622776 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 442 (R442L)
Ref Sequence ENSEMBL: ENSMUSP00000047923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000047903]
Predicted Effect probably benign
Transcript: ENSMUST00000030170
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000047903
AA Change: R442L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047923
Gene: ENSMUSG00000034807
AA Change: R442L

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 56 176 4.6e-22 PFAM
Pfam:Glyco_transf_25 335 520 8.8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212706
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two enzymes that transfers galactose moieties to hydroxylysine residues of collagen and mannose binding lectin. This gene is constitutively expressed and encodes a soluble protein that localizes to the endoplasmic reticulum. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adgrl4 G A 3: 151,542,686 C665Y probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Foxp1 A G 6: 99,016,631 V104A probably damaging Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Grm1 T A 10: 10,719,563 T774S probably damaging Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 V51I possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ptgs1 A G 2: 36,245,268 M415V probably benign Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Washc4 A C 10: 83,574,522 D658A probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Colgalt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Colgalt1 APN 8 71622776 missense probably damaging 1.00
IGL01888:Colgalt1 APN 8 71617674 missense probably damaging 1.00
IGL03191:Colgalt1 APN 8 71623087 splice site probably null
P0041:Colgalt1 UTSW 8 71622790 missense probably benign 0.05
R0094:Colgalt1 UTSW 8 71623158 missense probably damaging 1.00
R0094:Colgalt1 UTSW 8 71623158 missense probably damaging 1.00
R1342:Colgalt1 UTSW 8 71618160 missense probably damaging 1.00
R1642:Colgalt1 UTSW 8 71620757 missense probably benign 0.01
R1754:Colgalt1 UTSW 8 71623179 missense probably damaging 1.00
R1830:Colgalt1 UTSW 8 71623137 missense probably damaging 0.99
R1844:Colgalt1 UTSW 8 71611351 missense possibly damaging 0.84
R2050:Colgalt1 UTSW 8 71617686 critical splice donor site probably null
R2393:Colgalt1 UTSW 8 71623741 missense probably benign 0.00
R2406:Colgalt1 UTSW 8 71617668 missense probably damaging 1.00
R3897:Colgalt1 UTSW 8 71619662 missense probably damaging 1.00
R4210:Colgalt1 UTSW 8 71622706 missense probably benign 0.34
R4909:Colgalt1 UTSW 8 71620633 missense possibly damaging 0.80
R5995:Colgalt1 UTSW 8 71623110 missense probably damaging 1.00
R6170:Colgalt1 UTSW 8 71621870 missense probably damaging 1.00
R6994:Colgalt1 UTSW 8 71623521 missense probably damaging 1.00
R6995:Colgalt1 UTSW 8 71623521 missense probably damaging 1.00
R7155:Colgalt1 UTSW 8 71623710 missense probably damaging 0.99
X0066:Colgalt1 UTSW 8 71623596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGTGGGCAAATAGCTGG -3'
(R):5'- GGCTTGGCACAGGGAAATTG -3'

Sequencing Primer
(F):5'- TGGGCAAATAGCTGGATGTG -3'
(R):5'- AGACAGCAGAGCTCTGACGTC -3'
Posted On2016-09-01