Incidental Mutation 'R5428:Sntb1'
ID427035
Institutional Source Beutler Lab
Gene Symbol Sntb1
Ensembl Gene ENSMUSG00000060429
Gene Namesyntrophin, basic 1
Synonyms59-1 DAP, beta1-Syntrophin
MMRRC Submission 042994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5428 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location55636388-55906949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 55642795 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 461 (G461R)
Ref Sequence ENSEMBL: ENSMUSP00000041294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039769]
Predicted Effect probably damaging
Transcript: ENSMUST00000039769
AA Change: G461R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: G461R

DomainStartEndE-ValueType
PH 19 299 5.14e0 SMART
PDZ 120 194 4.5e-17 SMART
PH 322 434 2.81e-8 SMART
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,635,918 V324L probably benign Het
Abl2 T C 1: 156,642,111 C982R probably damaging Het
Adgrl4 G A 3: 151,542,686 C665Y probably damaging Het
Adra1d A G 2: 131,561,403 S256P probably damaging Het
Aipl1 T A 11: 72,030,487 Y194F probably benign Het
Arfgef1 C A 1: 10,160,835 D1150Y probably damaging Het
Arl14epl A T 18: 46,926,320 M1L possibly damaging Het
Colgalt1 G T 8: 71,622,776 R442L probably damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dach1 A G 14: 98,169,269 V14A unknown Het
Defa30 A G 8: 21,135,403 D61G probably benign Het
Dnaja2 A T 8: 85,540,175 C308S probably benign Het
Emc4 A G 2: 112,367,355 probably benign Het
Foxp1 A G 6: 99,016,631 V104A probably damaging Het
Fry T G 5: 150,405,359 L1319R possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gja10 T A 4: 32,601,169 H405L probably benign Het
Gm27047 A G 6: 130,630,564 noncoding transcript Het
Grm1 T A 10: 10,719,563 T774S probably damaging Het
Gtse1 A C 15: 85,862,139 D52A probably benign Het
Kctd17 T A 15: 78,428,782 F42Y probably damaging Het
Kndc1 A G 7: 139,908,962 K178E probably damaging Het
Lrrc74b T C 16: 17,558,261 E175G probably damaging Het
Macf1 A G 4: 123,384,868 I5927T probably damaging Het
Maml2 A G 9: 13,705,895 N935S probably benign Het
Man2a1 A G 17: 64,712,300 I720V probably benign Het
Map3k5 C T 10: 20,023,653 H219Y possibly damaging Het
Map4k5 T C 12: 69,838,013 T314A possibly damaging Het
Mast3 A G 8: 70,784,733 V615A possibly damaging Het
Mcmbp C T 7: 128,704,524 V457I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nacc1 T C 8: 84,676,154 I337V probably damaging Het
Nipbl T C 15: 8,330,296 D1475G probably benign Het
Orc1 T A 4: 108,599,940 D392E probably benign Het
Pappa2 T C 1: 158,814,785 T1297A possibly damaging Het
Plag1 C T 4: 3,905,538 V51I possibly damaging Het
Ppp1r12a G A 10: 108,253,347 E616K possibly damaging Het
Ptgs1 A G 2: 36,245,268 M415V probably benign Het
Ralgapa2 C T 2: 146,334,494 E1683K probably damaging Het
Rap2a T A 14: 120,478,994 F90I probably benign Het
Rcvrn A G 11: 67,700,049 E153G possibly damaging Het
Sharpin C A 15: 76,350,666 probably benign Het
Skil T A 3: 31,097,498 D56E probably benign Het
Slc22a18 G T 7: 143,479,345 G57W probably damaging Het
Synj1 T C 16: 90,991,518 D154G probably damaging Het
Tbc1d24 A T 17: 24,181,772 N156K probably benign Het
Tcea1 A T 1: 4,880,345 probably benign Het
Tmc3 T C 7: 83,612,547 V611A probably damaging Het
Tnrc6c A G 11: 117,700,762 M1V probably null Het
Tomm5 A T 4: 45,106,689 probably benign Het
Ttc6 A G 12: 57,689,834 K1207R probably null Het
Ttn T C 2: 76,761,104 T12747A possibly damaging Het
Ttn A T 2: 76,885,136 probably benign Het
Utrn T C 10: 12,693,431 D1147G probably benign Het
Vmn1r53 T C 6: 90,223,413 I310V probably benign Het
Washc4 A C 10: 83,574,522 D658A probably benign Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Ylpm1 T C 12: 85,030,229 F1243L probably benign Het
Zbtb24 T C 10: 41,464,788 S605P probably benign Het
Zfy1 T G Y: 726,205 H520P possibly damaging Het
Other mutations in Sntb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Sntb1 APN 15 55648039 missense possibly damaging 0.93
IGL02732:Sntb1 APN 15 55792200 missense possibly damaging 0.62
IGL02965:Sntb1 APN 15 55642685 nonsense probably null
IGL03084:Sntb1 APN 15 55792091 missense probably damaging 0.99
IGL03286:Sntb1 APN 15 55792046 missense possibly damaging 0.59
R0117:Sntb1 UTSW 15 55906353 missense probably benign
R0178:Sntb1 UTSW 15 55906144 missense probably damaging 0.98
R0465:Sntb1 UTSW 15 55749276 missense probably benign 0.02
R0626:Sntb1 UTSW 15 55642783 missense probably benign 0.20
R0726:Sntb1 UTSW 15 55676356 missense probably benign
R1125:Sntb1 UTSW 15 55749280 missense probably benign
R1443:Sntb1 UTSW 15 55647955 missense probably damaging 1.00
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R2208:Sntb1 UTSW 15 55906318 missense possibly damaging 0.79
R2426:Sntb1 UTSW 15 55906179 missense probably damaging 1.00
R3721:Sntb1 UTSW 15 55642818 missense probably benign 0.10
R4370:Sntb1 UTSW 15 55792091 missense probably damaging 0.99
R4706:Sntb1 UTSW 15 55749274 missense probably benign 0.09
R4883:Sntb1 UTSW 15 55642802 nonsense probably null
R5223:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5242:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5270:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5313:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5314:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5316:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5336:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5337:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5396:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5398:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5427:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5429:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5431:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5594:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5658:Sntb1 UTSW 15 55792076 missense probably damaging 1.00
R5665:Sntb1 UTSW 15 55792139 missense probably benign 0.00
R6147:Sntb1 UTSW 15 55648010 missense probably benign
R6159:Sntb1 UTSW 15 55676302 critical splice donor site probably null
R6883:Sntb1 UTSW 15 55906323 missense probably benign 0.38
R7008:Sntb1 UTSW 15 55792072 nonsense probably null
R7168:Sntb1 UTSW 15 55791265 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGTAAGTAGTCAGGCCGC -3'
(R):5'- AGAAATTCGTGGCTGGGCAC -3'

Sequencing Primer
(F):5'- TAAGTAGTCAGGCCGCCTACC -3'
(R):5'- CTGGGCACTGGGTTGAAG -3'
Posted On2016-09-01