Incidental Mutation 'R5429:Ghr'
ID427089
Institutional Source Beutler Lab
Gene Symbol Ghr
Ensembl Gene ENSMUSG00000055737
Gene Namegrowth hormone receptor
SynonymsGHR/BP, GHBP
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location3317760-3583492 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 3388675 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 37 (Q37*)
Ref Sequence ENSEMBL: ENSMUSP00000125044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069451] [ENSMUST00000110697] [ENSMUST00000110698] [ENSMUST00000161561] [ENSMUST00000161770]
Predicted Effect probably null
Transcript: ENSMUST00000069451
AA Change: Q37*
SMART Domains Protein: ENSMUSP00000069457
Gene: ENSMUSG00000055737
AA Change: Q37*

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 3.6e-12 PFAM
FN3 159 249 3.99e0 SMART
transmembrane domain 274 296 N/A INTRINSIC
Pfam:GHBP 325 636 2.1e-110 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110697
AA Change: Q37*
SMART Domains Protein: ENSMUSP00000106325
Gene: ENSMUSG00000055737
AA Change: Q37*

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 5.4e-13 PFAM
FN3 159 249 3.99e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110698
AA Change: Q37*
SMART Domains Protein: ENSMUSP00000106326
Gene: ENSMUSG00000055737
AA Change: Q37*

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 5.4e-13 PFAM
FN3 159 249 3.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161180
Predicted Effect probably null
Transcript: ENSMUST00000161561
AA Change: Q37*
SMART Domains Protein: ENSMUSP00000124064
Gene: ENSMUSG00000055737
AA Change: Q37*

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 3.6e-12 PFAM
FN3 159 249 3.99e0 SMART
transmembrane domain 274 296 N/A INTRINSIC
Pfam:GHBP 325 628 1.8e-132 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161770
AA Change: Q37*
SMART Domains Protein: ENSMUSP00000125044
Gene: ENSMUSG00000055737
AA Change: Q37*

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 2.4e-13 PFAM
Blast:FN3 159 183 9e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162993
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family, which is a transmembrane receptor for growth hormone. Binding of growth hormone to the receptor leads to receptor dimerization and the activation of an intra- and intercellular signal transduction pathway leading to growth. Mutations in this gene have been associated with Laron syndrome, also known as the growth hormone insensitivity syndrome (GHIS), a disorder characterized by short stature. In humans and rabbits, but not rodents, growth hormone binding protein (GHBP) is generated by proteolytic cleavage of the extracellular ligand-binding domain from the mature growth hormone receptor protein. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded postnatal growth, proportionate dwarfism, decreased plasma insulin-like growth factor I levels, small pituitaries, reduced fecundity in females, and extended life-span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Csrnp2 A G 15: 100,482,054 V452A probably benign Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Ghr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ghr APN 15 3328120 missense probably benign 0.00
IGL01366:Ghr APN 15 3320187 missense probably damaging 1.00
IGL01446:Ghr APN 15 3333355 missense probably damaging 1.00
IGL01730:Ghr APN 15 3320584 missense probably damaging 1.00
IGL01908:Ghr APN 15 3320447 nonsense probably null
IGL02396:Ghr APN 15 3457998 start codon destroyed probably null 0.99
IGL02476:Ghr APN 15 3320046 missense probably damaging 1.00
IGL02863:Ghr APN 15 3328102 nonsense probably null
IGL03338:Ghr APN 15 3347542 missense probably damaging 1.00
gnome UTSW 15 3388646 critical splice donor site probably null
R0334:Ghr UTSW 15 3341098 splice site probably benign
R0387:Ghr UTSW 15 3319891 missense probably benign
R0581:Ghr UTSW 15 3388634 splice site probably benign
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1216:Ghr UTSW 15 3319855 missense probably damaging 1.00
R1294:Ghr UTSW 15 3388646 critical splice donor site probably null
R1607:Ghr UTSW 15 3320574 missense probably damaging 1.00
R1743:Ghr UTSW 15 3320241 missense probably benign 0.06
R2006:Ghr UTSW 15 3327982 missense probably damaging 0.98
R2197:Ghr UTSW 15 3333474 nonsense probably null
R2274:Ghr UTSW 15 3320025 missense probably benign 0.00
R2332:Ghr UTSW 15 3320409 missense probably benign 0.16
R4283:Ghr UTSW 15 3333448 missense possibly damaging 0.73
R4519:Ghr UTSW 15 3333488 missense probably damaging 1.00
R4521:Ghr UTSW 15 3325958 missense probably damaging 1.00
R4714:Ghr UTSW 15 3320397 missense possibly damaging 0.91
R4717:Ghr UTSW 15 3319753 missense possibly damaging 0.81
R4724:Ghr UTSW 15 3325940 missense probably benign 0.31
R5087:Ghr UTSW 15 3320140 missense probably damaging 1.00
R5269:Ghr UTSW 15 3320079 missense probably benign 0.16
R6012:Ghr UTSW 15 3340927 missense probably damaging 0.98
R6135:Ghr UTSW 15 3325965 missense probably benign 0.04
R6588:Ghr UTSW 15 3320268 missense probably benign 0.14
R7069:Ghr UTSW 15 3320484 missense probably damaging 1.00
R7074:Ghr UTSW 15 3333391 missense probably damaging 1.00
R7408:Ghr UTSW 15 3347572 missense probably benign 0.00
R7540:Ghr UTSW 15 3319914 missense possibly damaging 0.72
X0017:Ghr UTSW 15 3320694 missense probably damaging 1.00
X0064:Ghr UTSW 15 3320212 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGCATAATAAAGCCTTCTCTTAACC -3'
(R):5'- AAAAGGCTTCCATTTGCTCTG -3'

Sequencing Primer
(F):5'- TAAAGCCTTCTCTTAACCTGCAAG -3'
(R):5'- CCATTTGCTCTGACTTTACAAGC -3'
Posted On2016-09-01