Incidental Mutation 'R5429:Csrnp2'
ID427092
Institutional Source Beutler Lab
Gene Symbol Csrnp2
Ensembl Gene ENSMUSG00000044636
Gene Namecysteine-serine-rich nuclear protein 2
SynonymsCSRNP-2
MMRRC Submission 042995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5429 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location100479570-100495488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100482054 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 452 (V452A)
Ref Sequence ENSEMBL: ENSMUSP00000052144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037001] [ENSMUST00000061457] [ENSMUST00000229012] [ENSMUST00000229648] [ENSMUST00000230294]
Predicted Effect probably benign
Transcript: ENSMUST00000037001
SMART Domains Protein: ENSMUSP00000037546
Gene: ENSMUSG00000037353

DomainStartEndE-ValueType
Pfam:LETM1 78 346 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061457
AA Change: V452A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052144
Gene: ENSMUSG00000044636
AA Change: V452A

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:CSRNP_N 61 280 5e-106 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229596
Predicted Effect probably benign
Transcript: ENSMUST00000229648
Predicted Effect probably benign
Transcript: ENSMUST00000230294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231001
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CSRNP family of nuclear proteins that share conserved regions, including cysteine- and serine- rich regions, a basic domain, a transcriptional activation domain, and bind the sequence 'AGAGTG', thus have the hallmark of transcription factors. Studies in mice suggest that these genes may have redundant functions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy and display normal development, hematopoiesis and T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik G A 13: 66,431,828 P199S probably benign Het
Akap13 T G 7: 75,602,904 S261A possibly damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Auts2 G A 5: 131,472,335 T289M probably damaging Het
Btaf1 G A 19: 36,994,857 V1331I possibly damaging Het
Ciz1 T A 2: 32,376,043 I609K possibly damaging Het
Clca3b C T 3: 144,846,459 V154I probably damaging Het
Csde1 A G 3: 103,052,841 T564A possibly damaging Het
Ctnnd1 C T 2: 84,616,789 V371M probably damaging Het
Dock6 T C 9: 21,832,881 D677G probably damaging Het
Filip1l A T 16: 57,570,255 E402V probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ghr G A 15: 3,388,675 Q37* probably null Het
Gm10770 C T 2: 150,179,423 R58H probably benign Het
Gm12789 T C 4: 101,989,961 Y148H possibly damaging Het
Herc4 T A 10: 63,275,013 N234K probably benign Het
Itih3 A G 14: 30,923,521 V10A probably benign Het
Kat14 T A 2: 144,393,323 D234E probably benign Het
Kif13a A G 13: 46,772,769 probably null Het
Kif2b A G 11: 91,577,229 V76A probably benign Het
Mboat1 A G 13: 30,219,667 T150A probably benign Het
Mfsd1 T A 3: 67,599,960 L398H probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfx1 T C 4: 41,004,343 C705R probably damaging Het
Olfr318 T A 11: 58,720,524 N175Y probably damaging Het
Olfr60 A G 7: 140,345,273 F239L possibly damaging Het
Pcdh10 T C 3: 45,384,200 S931P probably benign Het
Pdpk1 T C 17: 24,091,560 E205G probably benign Het
Ppp2r2a A T 14: 67,023,756 F172I probably damaging Het
Ppp2r5e T A 12: 75,453,763 D452V probably damaging Het
Rims2 A T 15: 39,345,355 T185S probably damaging Het
Rpusd4 T C 9: 35,272,602 V209A probably benign Het
Safb T C 17: 56,588,822 V20A probably benign Het
Scaf8 C A 17: 3,197,110 P903T probably benign Het
Slc30a7 A G 3: 116,006,925 S31P possibly damaging Het
Slc9b1 T C 3: 135,373,263 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Tbc1d32 T C 10: 56,027,993 D1226G probably damaging Het
Tlnrd1 G T 7: 83,882,314 T303N probably damaging Het
Tmc1 G T 19: 20,789,622 N738K possibly damaging Het
Tmem41a A G 16: 21,934,856 I255T probably benign Het
Trim7 G A 11: 48,849,955 C293Y probably damaging Het
Trpc6 C T 9: 8,634,074 Q385* probably null Het
Ttc39b A G 4: 83,243,953 I330T possibly damaging Het
Vil1 C T 1: 74,432,331 T757I probably benign Het
Zfp462 T C 4: 55,060,077 V1201A probably damaging Het
Zfp473 T A 7: 44,732,848 E686V possibly damaging Het
Other mutations in Csrnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Csrnp2 APN 15 100484643 missense probably benign 0.21
R0674:Csrnp2 UTSW 15 100487991 missense probably damaging 1.00
R1988:Csrnp2 UTSW 15 100489440 missense probably damaging 1.00
R3683:Csrnp2 UTSW 15 100481998 missense probably benign
R4688:Csrnp2 UTSW 15 100482360 missense probably damaging 0.97
R4846:Csrnp2 UTSW 15 100484690 missense probably damaging 1.00
R5678:Csrnp2 UTSW 15 100481804 makesense probably null
R6056:Csrnp2 UTSW 15 100482382 missense probably benign 0.23
R6765:Csrnp2 UTSW 15 100482693 missense probably damaging 1.00
R6925:Csrnp2 UTSW 15 100481958 missense probably benign 0.03
R7513:Csrnp2 UTSW 15 100482416 missense probably benign 0.10
X0020:Csrnp2 UTSW 15 100484703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTGTCCGTTCGGAAGG -3'
(R):5'- ATTCTCATCCAGGCTCAGCTG -3'

Sequencing Primer
(F):5'- TCCGTTCGGAAGGGTAGGC -3'
(R):5'- CGTCCTGTGTTTTACTGAGAAC -3'
Posted On2016-09-01