Incidental Mutation 'R5430:Sema3a'
ID427121
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
SynonymsSemad, semaphorin III, SemD, sema III, collapsin-1
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5430 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location13125414-13602565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13565763 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 385 (T385S)
Ref Sequence ENSEMBL: ENSMUSP00000092621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000137798]
Predicted Effect probably damaging
Transcript: ENSMUST00000030714
AA Change: T385S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883
AA Change: T385S

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095012
AA Change: T385S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883
AA Change: T385S

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137798
AA Change: T385S

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883
AA Change: T385S

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Brsk1 T C 7: 4,710,436 F702L probably benign Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11127 C T 17: 36,056,075 V359I probably benign Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Melk A G 4: 44,309,033 H130R probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr1258 A T 2: 89,929,913 I35F probably benign Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Olfr720 C T 14: 14,175,692 R130H probably benign Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Slc38a8 A G 8: 119,494,220 I200T probably benign Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn1r238 G T 18: 3,122,521 L298M possibly damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13473466 missense probably damaging 1.00
IGL01783:Sema3a APN 5 13561800 missense probably damaging 1.00
IGL02423:Sema3a APN 5 13565809 missense probably damaging 1.00
IGL02728:Sema3a APN 5 13565914 missense probably damaging 1.00
IGL02739:Sema3a APN 5 13451161 missense probably damaging 1.00
IGL02987:Sema3a APN 5 13565896 missense probably damaging 1.00
IGL03106:Sema3a APN 5 13599488 missense probably damaging 1.00
R0055:Sema3a UTSW 5 13400037 missense possibly damaging 0.92
R0334:Sema3a UTSW 5 13557301 missense probably damaging 0.99
R0684:Sema3a UTSW 5 13556527 critical splice acceptor site probably null
R0750:Sema3a UTSW 5 13557125 critical splice donor site probably null
R1204:Sema3a UTSW 5 13523175 critical splice donor site probably benign
R1221:Sema3a UTSW 5 13516223 missense probably benign
R1484:Sema3a UTSW 5 13473440 missense probably damaging 1.00
R1663:Sema3a UTSW 5 13557125 critical splice donor site probably null
R2079:Sema3a UTSW 5 13451131 missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13473397 critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13570157 missense probably damaging 1.00
R4867:Sema3a UTSW 5 13451241 missense probably benign 0.05
R4904:Sema3a UTSW 5 13581098 missense probably damaging 1.00
R5107:Sema3a UTSW 5 13577604 nonsense probably null
R5327:Sema3a UTSW 5 13599389 missense probably benign 0.25
R5343:Sema3a UTSW 5 13473406 missense probably damaging 1.00
R5604:Sema3a UTSW 5 13473520 critical splice donor site probably null
R5774:Sema3a UTSW 5 13523164 missense probably damaging 1.00
R6057:Sema3a UTSW 5 13565865 missense probably damaging 1.00
R6110:Sema3a UTSW 5 13581001 missense probably damaging 1.00
R6132:Sema3a UTSW 5 13523175 critical splice donor site probably null
R6310:Sema3a UTSW 5 13557019 missense probably damaging 1.00
R6754:Sema3a UTSW 5 13599275 missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13597616 missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13455544 missense possibly damaging 0.88
X0064:Sema3a UTSW 5 13581098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACTAAACAGCAATTAACATGGAG -3'
(R):5'- GCATCCACTCGGTCTACAAC -3'

Sequencing Primer
(F):5'- GCAGGTGATAACTAATGCTT -3'
(R):5'- CACTCGGTCTACAACAATTTGTGTG -3'
Posted On2016-09-01