Incidental Mutation 'R5441:Fcrla'
ID427157
Institutional Source Beutler Lab
Gene Symbol Fcrla
Ensembl Gene ENSMUSG00000038421
Gene NameFc receptor-like A
SynonymsFREB, Fcrx, Freb1, mFcrX, mFREB, FCRL1
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170917576-170927583 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 170925422 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046322] [ENSMUST00000159149] [ENSMUST00000159171] [ENSMUST00000162136] [ENSMUST00000162887]
Predicted Effect probably benign
Transcript: ENSMUST00000046322
SMART Domains Protein: ENSMUSP00000036380
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
IG 95 177 5.75e-4 SMART
IG 188 272 1.4e-7 SMART
low complexity region 281 296 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159149
SMART Domains Protein: ENSMUSP00000125074
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
IG 66 148 5.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159171
SMART Domains Protein: ENSMUSP00000124853
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
IG 94 176 5.75e-4 SMART
IG 187 271 1.4e-7 SMART
low complexity region 280 295 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161050
Predicted Effect probably benign
Transcript: ENSMUST00000162136
SMART Domains Protein: ENSMUSP00000124859
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:Ig_2 83 150 2.2e-6 PFAM
Pfam:Ig_2 156 215 1e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162887
SMART Domains Protein: ENSMUSP00000124469
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
Pfam:Ig_2 28 78 1.4e-7 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to receptors for the Fc fragment of gamma immunoglobulin (IgG). These receptors, referred to as FCGRs, mediate the destruction of IgG-coated antigens and of cells induced by antibodies. This encoded protein is selectively expressed in B cells, and may be involved in their development. This protein may also be involved in the development of lymphomas. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit largely normal T-dependent and T-independent antibody responses with an increase in IgG1 after secondary challenge with sheep red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Fcrla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Fcrla APN 1 170927498 missense probably benign 0.00
IGL01712:Fcrla APN 1 170921623 unclassified probably null
IGL03323:Fcrla APN 1 170927545 utr 5 prime probably benign
R0113:Fcrla UTSW 1 170922299 start codon destroyed probably null 0.66
R1457:Fcrla UTSW 1 170921004 missense probably damaging 1.00
R1917:Fcrla UTSW 1 170927526 nonsense probably null
R4331:Fcrla UTSW 1 170921676 missense possibly damaging 0.74
R4819:Fcrla UTSW 1 170920939 missense probably damaging 0.99
R4923:Fcrla UTSW 1 170921113 missense probably damaging 1.00
R5000:Fcrla UTSW 1 170922390 missense probably benign 0.03
R5459:Fcrla UTSW 1 170918169 missense possibly damaging 0.68
R6575:Fcrla UTSW 1 170922228 missense probably damaging 1.00
R7369:Fcrla UTSW 1 170922317 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATGGTTCAATGGGAGGTATTATCC -3'
(R):5'- ACTCTCAGGTCAAAATGGCGG -3'

Sequencing Primer
(F):5'- CCTCGTTTTTACAACAGGGAAAAGTG -3'
(R):5'- TCAAAATGGCGGGCCGATC -3'
Posted On2016-09-01