Incidental Mutation 'R5441:Rpe65'
ID427166
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Nameretinal pigment epithelium 65
SynonymsA930029L06Rik, Mord1, rd12
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location159599175-159625321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 159604401 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 104 (G104C)
Ref Sequence ENSEMBL: ENSMUSP00000143654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999] [ENSMUST00000197771]
Predicted Effect probably damaging
Transcript: ENSMUST00000029824
AA Change: G104C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: G104C

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196999
AA Change: G104C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: G104C

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197771
SMART Domains Protein: ENSMUSP00000143390
Gene: ENSMUSG00000028174

DomainStartEndE-ValueType
Pfam:RPE65 13 109 5.8e-19 PFAM
Meta Mutation Damage Score 0.654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159614542 missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159600405 splice site probably benign
IGL01815:Rpe65 APN 3 159604530 splice site probably null
IGL02085:Rpe65 APN 3 159615646 missense probably benign 0.00
IGL02232:Rpe65 APN 3 159604351 missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159624705 missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159606491 missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159622877 missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159600361 missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159604341 missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159614517 missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159615577 missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159624723 missense probably benign 0.35
R0571:Rpe65 UTSW 3 159600349 missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159601583 missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159606485 missense probably benign 0.07
R1597:Rpe65 UTSW 3 159614784 missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159614448 missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159622848 missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159615670 missense probably benign
R2259:Rpe65 UTSW 3 159615571 missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159604563 missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159604400 missense probably benign 0.16
R3975:Rpe65 UTSW 3 159604585 missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159604410 missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159624681 missense probably benign
R4924:Rpe65 UTSW 3 159622631 missense probably benign 0.01
R5269:Rpe65 UTSW 3 159604347 missense probably benign 0.07
R5324:Rpe65 UTSW 3 159604404 missense possibly damaging 0.94
R5854:Rpe65 UTSW 3 159615676 missense probably benign
R5907:Rpe65 UTSW 3 159615682 critical splice donor site probably null
R6149:Rpe65 UTSW 3 159614143 missense probably benign
R6660:Rpe65 UTSW 3 159614708 missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159614168 missense probably benign 0.06
R7025:Rpe65 UTSW 3 159622685 missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159615591 missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159622854 missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159624729 missense probably benign 0.13
R7537:Rpe65 UTSW 3 159604609 missense not run
Predicted Primers PCR Primer
(F):5'- AGTCTCTCTATCACCGGCTTGG -3'
(R):5'- AGTAATCTTCTCCCACTGGGTAG -3'

Sequencing Primer
(F):5'- ACCGGCTTGGGGAGATTC -3'
(R):5'- CTCCCACTGGGTAGATATTTACAAGG -3'
Posted On2016-09-01