Incidental Mutation 'R5441:C87414'
ID427169
Institutional Source Beutler Lab
Gene Symbol C87414
Ensembl Gene ENSMUSG00000070686
Gene Nameexpressed sequence C87414
Synonyms
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5441 (G1)
Quality Score104
Status Not validated
Chromosome5
Chromosomal Location93634993-93671551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93636597 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 139 (M139K)
Ref Sequence ENSEMBL: ENSMUSP00000075662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076321] [ENSMUST00000159578] [ENSMUST00000160382] [ENSMUST00000162964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076321
AA Change: M139K

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075662
Gene: ENSMUSG00000070686
AA Change: M139K

DomainStartEndE-ValueType
SCOP:d1a4ya_ 67 191 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159691
Predicted Effect probably benign
Transcript: ENSMUST00000160382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161919
Predicted Effect probably benign
Transcript: ENSMUST00000162964
AA Change: M336K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124780
Gene: ENSMUSG00000070686
AA Change: M336K

DomainStartEndE-ValueType
SCOP:d1a4ya_ 199 388 1e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in C87414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:C87414 APN 5 93636477 missense probably damaging 1.00
IGL01642:C87414 APN 5 93636295 missense possibly damaging 0.84
IGL02735:C87414 APN 5 93638644 missense possibly damaging 0.94
PIT4466001:C87414 UTSW 5 93636288 missense probably damaging 1.00
R1830:C87414 UTSW 5 93637686 missense probably benign 0.03
R2071:C87414 UTSW 5 93636516 missense probably damaging 1.00
R4404:C87414 UTSW 5 93637713 missense possibly damaging 0.81
R4606:C87414 UTSW 5 93636602 missense probably damaging 0.96
R4672:C87414 UTSW 5 93636323 missense probably damaging 0.99
R5056:C87414 UTSW 5 93638925 start gained probably benign
R5118:C87414 UTSW 5 93637797 missense probably benign 0.03
R5288:C87414 UTSW 5 93637748 missense possibly damaging 0.86
R6190:C87414 UTSW 5 93638078 missense probably benign 0.14
R6513:C87414 UTSW 5 93637532 unclassified probably null
R7464:C87414 UTSW 5 93636240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGAAAAGGGCCTTCAG -3'
(R):5'- GGGCCCCTGGTTTATTCTAC -3'

Sequencing Primer
(F):5'- CTTCAGGGTGCACATGGAG -3'
(R):5'- ACTACTTTTTAGAACTAACCCTCTGG -3'
Posted On2016-09-01